Gene Page: KIF21A
Summary ?
GeneID | 55605 |
Symbol | KIF21A |
Synonyms | CFEOM1|FEOM1|FEOM3A |
Description | kinesin family member 21A |
Reference | MIM:608283|HGNC:HGNC:19349|Ensembl:ENSG00000139116|HPRD:10506|Vega:OTTHUMG00000169335 |
Gene type | protein-coding |
Map location | 12q12 |
Pascal p-value | 0.006 |
Sherlock p-value | 0.09 |
eGene | Myers' cis & trans |
Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10994209 | chr10 | 61877705 | KIF21A | 55605 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
HRCT1 | 0.55 | 0.26 |
EDN1 | 0.55 | 0.15 |
AC010300.1 | 0.50 | 0.38 |
EGFL8 | 0.48 | 0.41 |
SH3TC1 | 0.46 | 0.13 |
LIMS2 | 0.46 | 0.32 |
MYLK2 | 0.45 | 0.28 |
AF347015.18 | 0.45 | 0.21 |
SPATC1 | 0.45 | 0.37 |
TMEM204 | 0.44 | 0.15 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TMEM59 | -0.45 | -0.49 |
ARMC10 | -0.44 | -0.46 |
SLC25A3 | -0.44 | -0.43 |
C1orf43 | -0.43 | -0.44 |
GRINL1A | -0.43 | -0.47 |
YPEL5 | -0.43 | -0.46 |
KCMF1 | -0.43 | -0.42 |
PTP4A2 | -0.42 | -0.54 |
SEH1L | -0.42 | -0.44 |
GOLGA7 | -0.42 | -0.45 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003777 | microtubule motor activity | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007018 | microtubule-based movement | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005874 | microtubule | IEA | - | |
GO:0005875 | microtubule associated complex | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
CORRE MULTIPLE MYELOMA DN | 62 | 41 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE UP | 136 | 80 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
APPIERTO RESPONSE TO FENRETINIDE UP | 38 | 26 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
WILLIAMS ESR2 TARGETS UP | 28 | 18 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER METASTASIS DN | 121 | 65 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 AND CD2 UP | 89 | 51 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
WANG CISPLATIN RESPONSE AND XPC UP | 202 | 115 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
BONCI TARGETS OF MIR15A AND MIR16 1 | 91 | 75 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 6HR UP | 229 | 149 | All SZGR 2.0 genes in this pathway |
LINSLEY MIR16 TARGETS | 206 | 127 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
WANG MLL TARGETS | 289 | 188 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-103/107 | 848 | 854 | m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-145 | 105 | 112 | 1A,m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-15/16/195/424/497 | 849 | 856 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-485-3p | 980 | 987 | 1A,m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
miR-503 | 850 | 856 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
miR-9 | 622 | 628 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.