Gene Page: BTBD2
Summary ?
| GeneID | 55643 |
| Symbol | BTBD2 |
| Synonyms | - |
| Description | BTB domain containing 2 |
| Reference | MIM:608531|HGNC:HGNC:15504|Ensembl:ENSG00000133243|HPRD:12252|Vega:OTTHUMG00000180017 |
| Gene type | protein-coding |
| Map location | 19p13.3 |
| Pascal p-value | 0.001 |
| Sherlock p-value | 0.753 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0547 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| PCBP2 | 0.93 | 0.92 |
| RBBP4 | 0.92 | 0.91 |
| NONO | 0.92 | 0.90 |
| RBMX | 0.91 | 0.89 |
| ZNF143 | 0.91 | 0.90 |
| BUB3 | 0.91 | 0.93 |
| SNRNP40 | 0.91 | 0.90 |
| NUP88 | 0.91 | 0.90 |
| APEX1 | 0.91 | 0.86 |
| SF3B3 | 0.91 | 0.91 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.70 | -0.86 |
| AF347015.27 | -0.70 | -0.87 |
| MT-CO2 | -0.70 | -0.87 |
| AF347015.33 | -0.69 | -0.85 |
| AF347015.8 | -0.69 | -0.87 |
| MT-CYB | -0.68 | -0.85 |
| AF347015.15 | -0.67 | -0.86 |
| FXYD1 | -0.65 | -0.83 |
| AIFM3 | -0.65 | -0.74 |
| AF347015.2 | -0.65 | -0.85 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 16169070 |18305892 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| BRD7 | BP75 | CELTIX1 | NAG4 | bromodomain containing 7 | Two-hybrid | BioGRID | 16169070 |
| C14orf1 | ERG28 | NET51 | chromosome 14 open reading frame 1 | Two-hybrid | BioGRID | 16169070 |
| C7orf64 | DKFZP564O0523 | DKFZp686D1651 | HSPC304 | chromosome 7 open reading frame 64 | Two-hybrid | BioGRID | 16169070 |
| CCDC90B | MDS011 | MDS025 | MGC104239 | coiled-coil domain containing 90B | Two-hybrid | BioGRID | 16169070 |
| COPS6 | CSN6 | MOV34-34KD | COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) | Two-hybrid | BioGRID | 16169070 |
| CRMP1 | DPYSL1 | DRP-1 | DRP1 | collapsin response mediator protein 1 | Two-hybrid | BioGRID | 16169070 |
| EEF1A1 | CCS-3 | CCS3 | EEF-1 | EEF1A | EF-Tu | EF1A | FLJ25721 | GRAF-1EF | HNGC:16303 | LENG7 | MGC102687 | MGC131894 | MGC16224 | PTI1 | eEF1A-1 | eukaryotic translation elongation factor 1 alpha 1 | Two-hybrid | BioGRID | 16169070 |
| GAPDH | G3PD | GAPD | MGC88685 | glyceraldehyde-3-phosphate dehydrogenase | Two-hybrid | BioGRID | 16169070 |
| GBP2 | - | guanylate binding protein 2, interferon-inducible | Two-hybrid | BioGRID | 16169070 |
| GDF9 | - | growth differentiation factor 9 | Two-hybrid | BioGRID | 16169070 |
| IGSF21 | FLJ41177 | MGC15730 | immunoglobin superfamily, member 21 | Two-hybrid | BioGRID | 16169070 |
| PTN | HARP | HBGF8 | HBNF | NEGF1 | pleiotrophin | Two-hybrid | BioGRID | 16169070 |
| SETDB1 | ESET | KG1T | KIAA0067 | KMT1E | SET domain, bifurcated 1 | Two-hybrid | BioGRID | 16169070 |
| TLE1 | ESG | ESG1 | GRG1 | transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) | Two-hybrid | BioGRID | 16169070 |
| TOP1 | TOPI | topoisomerase (DNA) I | - | HPRD,BioGRID | 11818025 |
| TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | Two-hybrid | BioGRID | 16169070 |
| UBR1 | JBS | MGC142065 | MGC142067 | ubiquitin protein ligase E3 component n-recognin 1 | Two-hybrid | BioGRID | 16169070 |
| UNC119 | HRG4 | unc-119 homolog (C. elegans) | Two-hybrid | BioGRID | 16169070 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| WANG LMO4 TARGETS UP | 372 | 227 | All SZGR 2.0 genes in this pathway |
| BARRIER COLON CANCER RECURRENCE DN | 20 | 16 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC1 TARGETS DN | 260 | 143 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| MEINHOLD OVARIAN CANCER LOW GRADE UP | 19 | 15 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS DN | 261 | 155 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
| KAAB FAILED HEART ATRIUM UP | 38 | 30 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
| VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
| DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-135 | 966 | 972 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
| miR-33 | 373 | 379 | m8 | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
| hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.