Gene Page: PRKAB2
Summary ?
GeneID | 5565 |
Symbol | PRKAB2 |
Synonyms | - |
Description | protein kinase AMP-activated non-catalytic subunit beta 2 |
Reference | MIM:602741|HGNC:HGNC:9379|Ensembl:ENSG00000131791|HPRD:04117|Vega:OTTHUMG00000014032 |
Gene type | protein-coding |
Map location | 1q21.1 |
Fetal beta | 1.481 |
DMG | 1 (# studies) |
eGene | Cerebellar Hemisphere |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CNV:YES | Copy number variation studies | Manual curation | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg15188491 | 1 | 146644106 | PRKAB2 | 3E-9 | -0.018 | 2.08E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MATR3 | 0.95 | 0.95 |
STX7 | 0.94 | 0.94 |
CAND1 | 0.94 | 0.95 |
FYTTD1 | 0.93 | 0.94 |
EXOC5 | 0.93 | 0.94 |
DNAJC18 | 0.93 | 0.92 |
UBE3A | 0.93 | 0.95 |
IPO7 | 0.93 | 0.94 |
SMEK2 | 0.92 | 0.92 |
ABCE1 | 0.92 | 0.93 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FXYD1 | -0.70 | -0.87 |
AC018755.7 | -0.68 | -0.77 |
MT-CO2 | -0.67 | -0.82 |
AF347015.33 | -0.67 | -0.81 |
TSC22D4 | -0.66 | -0.78 |
AF347015.31 | -0.66 | -0.80 |
IFI27 | -0.66 | -0.82 |
HIGD1B | -0.66 | -0.83 |
AIFM3 | -0.65 | -0.75 |
HEPN1 | -0.65 | -0.75 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 17353931 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007165 | signal transduction | TAS | 9575201 | |
GO:0006633 | fatty acid biosynthetic process | IEA | - | |
GO:0046320 | regulation of fatty acid oxidation | EXP | 16054041 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005829 | cytosol | EXP | 15060529 | |
GO:0005654 | nucleoplasm | EXP | 10698692 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
KEGG ADIPOCYTOKINE SIGNALING PATHWAY | 67 | 57 | All SZGR 2.0 genes in this pathway |
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM | 85 | 65 | All SZGR 2.0 genes in this pathway |
BIOCARTA CHREBP2 PATHWAY | 42 | 35 | All SZGR 2.0 genes in this pathway |
BIOCARTA LEPTIN PATHWAY | 11 | 11 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATED AMPK STIMULATES FATTY ACID OXIDATION IN MUSCLE | 19 | 16 | All SZGR 2.0 genes in this pathway |
REACTOME INSULIN RECEPTOR SIGNALLING CASCADE | 87 | 64 | All SZGR 2.0 genes in this pathway |
REACTOME INTEGRATION OF ENERGY METABOLISM | 120 | 84 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF AMPK ACTIVITY VIA LKB1 | 15 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME ENERGY DEPENDENT REGULATION OF MTOR BY LKB1 AMPK | 18 | 15 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF RHEB GTPASE ACTIVITY BY AMPK | 10 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
REACTOME FATTY ACID TRIACYLGLYCEROL AND KETONE BODY METABOLISM | 168 | 115 | All SZGR 2.0 genes in this pathway |
REACTOME PKB MEDIATED EVENTS | 29 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY INSULIN RECEPTOR | 108 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME PI3K CASCADE | 71 | 51 | All SZGR 2.0 genes in this pathway |
ZHONG RESPONSE TO AZACITIDINE AND TSA UP | 183 | 119 | All SZGR 2.0 genes in this pathway |
HORIUCHI WTAP TARGETS UP | 306 | 188 | All SZGR 2.0 genes in this pathway |
RODRIGUES DCC TARGETS DN | 121 | 84 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 24HR DN | 148 | 102 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY UV | 62 | 43 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE DN | 195 | 135 | All SZGR 2.0 genes in this pathway |
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR UP | 174 | 96 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
LIN NPAS4 TARGETS UP | 163 | 100 | All SZGR 2.0 genes in this pathway |
KYNG WERNER SYNDROM AND NORMAL AGING UP | 93 | 62 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS UP | 221 | 135 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 30MIN DN | 150 | 99 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
GABRIELY MIR21 TARGETS | 289 | 187 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
KRIEG KDM3A TARGETS NOT HYPOXIA | 208 | 107 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-153 | 3322 | 3328 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-217 | 3886 | 3892 | 1A | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
miR-25/32/92/363/367 | 3324 | 3330 | 1A | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-29 | 4249 | 4255 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-320 | 167 | 173 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-448 | 3321 | 3328 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.