Gene Page: PRKCD
Summary ?
GeneID | 5580 |
Symbol | PRKCD |
Synonyms | ALPS3|CVID9|MAY1|PKCD|nPKC-delta |
Description | protein kinase C delta |
Reference | MIM:176977|HGNC:HGNC:9399|Ensembl:ENSG00000163932|HPRD:01501|Vega:OTTHUMG00000133659 |
Gene type | protein-coding |
Map location | 3p21.31 |
Pascal p-value | 0.002 |
Sherlock p-value | 0.92 |
DEG p-value | DEG:Sanders_2014:DS1_p=-0.148:DS1_beta=0.023100:DS2_p=1.17e-01:DS2_beta=-0.073:DS2_FDR=3.26e-01 |
Fetal beta | -2.255 |
eGene | Cortex Frontal Cortex BA9 Myers' cis & trans Meta |
Support | CANABINOID INTRACELLULAR SIGNAL TRANSDUCTION METABOTROPIC GLUTAMATE RECEPTOR SEROTONIN |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Sanders_2013 | Microarray | Whole-genome gene expression profiles using microarrays on lymphoblastoid cell lines (LCLs) from 413 cases and 446 controls. | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.1892 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs4862857 | chr4 | 189017057 | PRKCD | 5580 | 0.1 | trans | ||
rs4862858 | chr4 | 189017114 | PRKCD | 5580 | 0.1 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ZNF136 | 0.95 | 0.94 |
C17orf71 | 0.93 | 0.93 |
ZNF564 | 0.93 | 0.94 |
TOPORS | 0.93 | 0.92 |
MED17 | 0.93 | 0.92 |
TGS1 | 0.93 | 0.93 |
DIS3 | 0.92 | 0.93 |
ZNF14 | 0.92 | 0.91 |
ZNF254 | 0.92 | 0.93 |
CCNG2 | 0.92 | 0.92 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MT-CO2 | -0.74 | -0.87 |
FXYD1 | -0.73 | -0.87 |
AF347015.31 | -0.73 | -0.85 |
AF347015.33 | -0.72 | -0.84 |
MT-CYB | -0.71 | -0.84 |
AF347015.27 | -0.71 | -0.82 |
IFI27 | -0.71 | -0.83 |
S100B | -0.70 | -0.80 |
AF347015.8 | -0.70 | -0.85 |
HLA-F | -0.70 | -0.75 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0004697 | protein kinase C activity | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0008022 | protein C-terminus binding | IPI | 16611985 | |
GO:0008047 | enzyme activator activity | IDA | 16611985 | |
GO:0019992 | diacylglycerol binding | IEA | - | |
GO:0019899 | enzyme binding | IPI | 16611985 | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006468 | protein amino acid phosphorylation | IDA | 16611985 | |
GO:0016064 | immunoglobulin mediated immune response | IEA | - | |
GO:0007242 | intracellular signaling cascade | IEA | - | |
GO:0042100 | B cell proliferation | IEA | - | |
GO:0050821 | protein stabilization | NAS | 16611985 | |
GO:0032613 | interleukin-10 production | IEA | - | |
GO:0032615 | interleukin-12 production | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005829 | cytosol | EXP | 8976194 | |
GO:0005634 | nucleus | IDA | 16611985 | |
GO:0005737 | cytoplasm | IDA | 16611985 | |
GO:0016020 | membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ADAM9 | KIAA0021 | MCMP | MDC9 | Mltng | ADAM metallopeptidase domain 9 (meltrin gamma) | - | HPRD,BioGRID | 9857183 |
AFAP1 | AFAP | AFAP-110 | FLJ56849 | actin filament associated protein 1 | - | HPRD,BioGRID | 12134071 |
C1QBP | GC1QBP | HABP1 | SF2p32 | gC1Q-R | gC1qR | p32 | complement component 1, q subcomponent binding protein | - | HPRD,BioGRID | 10831594 |
CD34 | - | CD34 molecule | - | HPRD | 1694174 |
CDCP1 | CD318 | SIMA135 | TRASK | CUB domain containing protein 1 | PKC-delta interacts with CDCP1. | BIND | 15851033 |
FRAP1 | FLJ44809 | FRAP | FRAP2 | MTOR | RAFT1 | RAPT1 | FK506 binding protein 12-rapamycin associated protein 1 | Affinity Capture-Western | BioGRID | 10698949 |
GABRA1 | ECA4 | EJM | gamma-aminobutyric acid (GABA) A receptor, alpha 1 | Affinity Capture-Western | BioGRID | 12091471 |
GNA12 | MGC104623 | MGC99644 | NNX3 | RMP | gep | guanine nucleotide binding protein (G protein) alpha 12 | Biochemical Activity | BioGRID | 8824244 |
GNA13 | G13 | MGC46138 | guanine nucleotide binding protein (G protein), alpha 13 | - | HPRD,BioGRID | 8824244 |
GNB2L1 | Gnb2-rs1 | H12.3 | HLC-7 | PIG21 | RACK1 | guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 | PKC-delta interacts with RACK1. | BIND | 11884618 |
GSK3B | - | glycogen synthase kinase 3 beta | PKC-delta interacts with and phosphorylates GSK3-beta. This interaction was modeled on a demonstrated interaction between human PKC-delta and rabbit GSK3-beta. | BIND | 15824731 |
HABP4 | IHABP4 | Ki-1/57 | MGC825 | SERBP1L | hyaluronan binding protein 4 | - | HPRD | 14699138 |
IGF1R | CD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216 | insulin-like growth factor 1 receptor | PKC-delta interacts with IGF-IR. | BIND | 11884618 |
IL6ST | CD130 | CDw130 | GP130 | GP130-RAPS | IL6R-beta | interleukin 6 signal transducer (gp130, oncostatin M receptor) | - | HPRD,BioGRID | 12361954 |
IL6ST | CD130 | CDw130 | GP130 | GP130-RAPS | IL6R-beta | interleukin 6 signal transducer (gp130, oncostatin M receptor) | PKC-delta interacts with gp130. This interaction was modelled on a demonstrated interaction between mouse PKC-delta and human gp130. | BIND | 12361954 |
INPP5D | MGC104855 | MGC142140 | MGC142142 | SHIP | SHIP1 | SIP-145 | hp51CN | inositol polyphosphate-5-phosphatase, 145kDa | Affinity Capture-Western | BioGRID | 12024011 |
INSR | CD220 | HHF5 | insulin receptor | - | HPRD,BioGRID | 11266508 |
IRS1 | HIRS-1 | insulin receptor substrate 1 | - | HPRD,BioGRID | 12031982 |
LMNB1 | ADLD | LMN | LMN2 | LMNB | MGC111419 | lamin B1 | - | HPRD | 11901153 |
MBP | MGC99675 | myelin basic protein | PKC-delta phosphorylates and interacts with MBP. This interaction was modeled on a demonstrated interaction between PKC-delta and MBP, both from unspecified species. | BIND | 10383403 |
MUC1 | CD227 | EMA | H23AG | MAM6 | PEM | PEMT | PUM | mucin 1, cell surface associated | - | HPRD,BioGRID | 11877440 |
PDK1 | - | pyruvate dehydrogenase kinase, isozyme 1 | - | HPRD | 11781095 |
PDP2 | KIAA1348 | pyruvate dehydrogenase phosphatase isoenzyme 2 | - | HPRD,BioGRID | 11577086 |
PDPK1 | MGC20087 | MGC35290 | PDK1 | PRO0461 | 3-phosphoinositide dependent protein kinase-1 | - | HPRD,BioGRID | 11781095 |
PDPK1 | MGC20087 | MGC35290 | PDK1 | PRO0461 | 3-phosphoinositide dependent protein kinase-1 | PRKCD (PKCD) interacts with PDPK1 (PDK1). This interaction was modelled on a demonstrated interaction between human PRKCD and rat PDPK1. | BIND | 11781095 |
PEBP1 | HCNP | PBP | PEBP | RKIP | phosphatidylethanolamine binding protein 1 | PKCdelta interacts with and phosphorylates RKIP. This interaction was modelled on a demonstrated interaction between RKIP from an unspecified species and human PKCdelta. | BIND | 14654844 |
PIK3CB | DKFZp779K1237 | MGC133043 | PI3K | PI3KCB | PI3Kbeta | PIK3C1 | p110-BETA | phosphoinositide-3-kinase, catalytic, beta polypeptide | Affinity Capture-Western | BioGRID | 11676480 |
PLD2 | - | phospholipase D2 | - | HPRD,BioGRID | 11744693 |
PLSCR3 | - | phospholipid scramblase 3 | - | HPRD,BioGRID | 12649167 |
PPM2C | FLJ32517 | MGC119646 | PDH | PDP | PDP1 | PDPC | protein phosphatase 2C, magnesium-dependent, catalytic subunit | - | HPRD,BioGRID | 11577086 |
PPP2CA | PP2Ac | PP2CA | RP-C | protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform | Biochemical Activity | BioGRID | 11959144 |
PRKDC | DNA-PKcs | DNAPK | DNPK1 | HYRC | HYRC1 | XRCC7 | p350 | protein kinase, DNA-activated, catalytic polypeptide | - | HPRD | 9774685 |
PTK2B | CADTK | CAKB | FADK2 | FAK2 | FRNK | PKB | PTK | PYK2 | RAFTK | PTK2B protein tyrosine kinase 2 beta | - | HPRD,BioGRID | 11352632 |
PTPN6 | HCP | HCPH | HPTP1C | PTP-1C | SH-PTP1 | SHP-1 | SHP-1L | SHP1 | protein tyrosine phosphatase, non-receptor type 6 | - | HPRD,BioGRID | 11723252 |
RASGRP3 | GRP3 | KIAA0846 | RAS guanyl releasing protein 3 (calcium and DAG-regulated) | - | HPRD,BioGRID | 15213298 |
RIPK4 | ANKK2 | ANKRD3 | DIK | MGC129992 | MGC129993 | PKK | RIP4 | receptor-interacting serine-threonine kinase 4 | - | HPRD,BioGRID | 10948194 |
SHC1 | FLJ26504 | SHC | SHCA | SHC (Src homology 2 domain containing) transforming protein 1 | - | HPRD,BioGRID | 12024011 |
STAT1 | DKFZp686B04100 | ISGF-3 | STAT91 | signal transducer and activator of transcription 1, 91kDa | Affinity Capture-Western | BioGRID | 12807916 |
STAT3 | APRF | FLJ20882 | HIES | MGC16063 | signal transducer and activator of transcription 3 (acute-phase response factor) | PKC-delta interacts with Stat3. | BIND | 10446219 |
TIAM1 | FLJ36302 | T-cell lymphoma invasion and metastasis 1 | - | HPRD,BioGRID | 10212259 |
TNFRSF10B | CD262 | DR5 | KILLER | KILLER/DR5 | TRAIL-R2 | TRAILR2 | TRICK2 | TRICK2A | TRICK2B | TRICKB | ZTNFR9 | tumor necrosis factor receptor superfamily, member 10b | PRKCD (PKC-delta) interacts with TNFRSF10B (DR5) RARE. | BIND | 12805378 |
YWHAG | 14-3-3GAMMA | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide | - | HPRD,BioGRID | 10433554 |
YWHAZ | KCIP-1 | MGC111427 | MGC126532 | MGC138156 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide | Affinity Capture-Western | BioGRID | 11950841 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CHEMOKINE SIGNALING PATHWAY | 190 | 128 | All SZGR 2.0 genes in this pathway |
KEGG VASCULAR SMOOTH MUSCLE CONTRACTION | 115 | 81 | All SZGR 2.0 genes in this pathway |
KEGG TIGHT JUNCTION | 134 | 86 | All SZGR 2.0 genes in this pathway |
KEGG FC EPSILON RI SIGNALING PATHWAY | 79 | 58 | All SZGR 2.0 genes in this pathway |
KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS | 97 | 71 | All SZGR 2.0 genes in this pathway |
KEGG NEUROTROPHIN SIGNALING PATHWAY | 126 | 103 | All SZGR 2.0 genes in this pathway |
KEGG GNRH SIGNALING PATHWAY | 101 | 77 | All SZGR 2.0 genes in this pathway |
KEGG TYPE II DIABETES MELLITUS | 47 | 41 | All SZGR 2.0 genes in this pathway |
BIOCARTA HIVNEF PATHWAY | 58 | 43 | All SZGR 2.0 genes in this pathway |
BIOCARTA KERATINOCYTE PATHWAY | 46 | 38 | All SZGR 2.0 genes in this pathway |
PID ENDOTHELIN PATHWAY | 63 | 52 | All SZGR 2.0 genes in this pathway |
PID LYSOPHOSPHOLIPID PATHWAY | 66 | 53 | All SZGR 2.0 genes in this pathway |
PID TXA2PATHWAY | 57 | 43 | All SZGR 2.0 genes in this pathway |
PID NFAT 3PATHWAY | 54 | 47 | All SZGR 2.0 genes in this pathway |
PID IGF1 PATHWAY | 30 | 23 | All SZGR 2.0 genes in this pathway |
PID CERAMIDE PATHWAY | 48 | 37 | All SZGR 2.0 genes in this pathway |
PID IFNG PATHWAY | 40 | 34 | All SZGR 2.0 genes in this pathway |
PID ERBB1 DOWNSTREAM PATHWAY | 105 | 78 | All SZGR 2.0 genes in this pathway |
PID SYNDECAN 4 PATHWAY | 32 | 25 | All SZGR 2.0 genes in this pathway |
PID IL6 7 PATHWAY | 47 | 40 | All SZGR 2.0 genes in this pathway |
PID PDGFRB PATHWAY | 129 | 103 | All SZGR 2.0 genes in this pathway |
PID HEDGEHOG GLI PATHWAY | 48 | 35 | All SZGR 2.0 genes in this pathway |
PID VEGFR1 2 PATHWAY | 69 | 57 | All SZGR 2.0 genes in this pathway |
PID THROMBIN PAR1 PATHWAY | 43 | 32 | All SZGR 2.0 genes in this pathway |
PID SYNDECAN 2 PATHWAY | 33 | 27 | All SZGR 2.0 genes in this pathway |
PID TAP63 PATHWAY | 54 | 40 | All SZGR 2.0 genes in this pathway |
PID P53 REGULATION PATHWAY | 59 | 50 | All SZGR 2.0 genes in this pathway |
PID MAPK TRK PATHWAY | 34 | 31 | All SZGR 2.0 genes in this pathway |
PID PI3K PLC TRK PATHWAY | 36 | 31 | All SZGR 2.0 genes in this pathway |
PID ALPHA SYNUCLEIN PATHWAY | 33 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME APOPTOTIC CLEAVAGE OF CELLULAR PROTEINS | 40 | 26 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME DAG AND IP3 SIGNALING | 32 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ERBB2 | 101 | 78 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY EGFR IN CANCER | 109 | 80 | All SZGR 2.0 genes in this pathway |
REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE | 137 | 105 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY FGFR IN DISEASE | 127 | 88 | All SZGR 2.0 genes in this pathway |
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK | 205 | 136 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME OPIOID SIGNALLING | 78 | 56 | All SZGR 2.0 genes in this pathway |
REACTOME CA DEPENDENT EVENTS | 30 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME PLC BETA MEDIATED EVENTS | 43 | 32 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY PDGF | 122 | 93 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNAL TRANSDUCTION | 95 | 76 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA Q SIGNALLING EVENTS | 184 | 116 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA Z SIGNALLING EVENTS | 44 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF MRNA | 284 | 128 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF RNA | 330 | 155 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNALING OF ACTIVATED FGFR | 100 | 74 | All SZGR 2.0 genes in this pathway |
REACTOME PHOSPHOLIPASE C MEDIATED CASCADE | 54 | 40 | All SZGR 2.0 genes in this pathway |
REACTOME EFFECTS OF PIP2 HYDROLYSIS | 25 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF MRNA STABILITY BY PROTEINS THAT BIND AU RICH ELEMENTS | 84 | 50 | All SZGR 2.0 genes in this pathway |
REACTOME INTERFERON GAMMA SIGNALING | 63 | 48 | All SZGR 2.0 genes in this pathway |
REACTOME INTERFERON SIGNALING | 159 | 116 | All SZGR 2.0 genes in this pathway |
REACTOME APOPTOSIS | 148 | 94 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION | 208 | 138 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY FGFR | 112 | 80 | All SZGR 2.0 genes in this pathway |
REACTOME APOPTOTIC EXECUTION PHASE | 54 | 37 | All SZGR 2.0 genes in this pathway |
WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE UP | 108 | 67 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA MYELOID DN | 38 | 25 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN | 187 | 115 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS UP | 214 | 155 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 8HR UP | 164 | 122 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
COLDREN GEFITINIB RESISTANCE DN | 230 | 115 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
CREIGHTON AKT1 SIGNALING VIA MTOR UP | 34 | 22 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
OUELLET OVARIAN CANCER INVASIVE VS LMP UP | 117 | 85 | All SZGR 2.0 genes in this pathway |
GALLUZZI PERMEABILIZE MITOCHONDRIA | 43 | 31 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
GUENTHER GROWTH SPHERICAL VS ADHERENT DN | 26 | 19 | All SZGR 2.0 genes in this pathway |
SHIN B CELL LYMPHOMA CLUSTER 2 | 30 | 23 | All SZGR 2.0 genes in this pathway |
COLLIS PRKDC REGULATORS | 15 | 10 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS | 185 | 114 | All SZGR 2.0 genes in this pathway |
NEMETH INFLAMMATORY RESPONSE LPS UP | 88 | 64 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED UP | 183 | 111 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
ABE VEGFA TARGETS 2HR | 34 | 21 | All SZGR 2.0 genes in this pathway |
WU HBX TARGETS 2 DN | 16 | 11 | All SZGR 2.0 genes in this pathway |
WU HBX TARGETS 1 DN | 23 | 14 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
MARIADASON REGULATED BY HISTONE ACETYLATION UP | 83 | 49 | All SZGR 2.0 genes in this pathway |
MA PITUITARY FETAL VS ADULT UP | 29 | 21 | All SZGR 2.0 genes in this pathway |
DELLA RESPONSE TO TSA AND BUTYRATE | 21 | 17 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D7 | 40 | 21 | All SZGR 2.0 genes in this pathway |
GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
YIH RESPONSE TO ARSENITE C3 | 36 | 24 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 9 | 92 | 59 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS DN | 145 | 93 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS DN | 210 | 128 | All SZGR 2.0 genes in this pathway |
MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
WU SILENCED BY METHYLATION IN BLADDER CANCER | 55 | 42 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A4 | 196 | 124 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS PROLIFERATION UP | 178 | 108 | All SZGR 2.0 genes in this pathway |
YAMASHITA LIVER CANCER STEM CELL UP | 47 | 38 | All SZGR 2.0 genes in this pathway |
YAMASHITA LIVER CANCER STEM CELL DN | 76 | 51 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 DN | 45 | 30 | All SZGR 2.0 genes in this pathway |
LI INDUCED T TO NATURAL KILLER DN | 116 | 83 | All SZGR 2.0 genes in this pathway |
MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
ZWANG EGF INTERVAL DN | 214 | 124 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-181 | 230 | 237 | 1A,m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-218 | 389 | 395 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-26 | 226 | 233 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-27 | 159 | 165 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-369-3p | 257 | 263 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 257 | 263 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-410 | 259 | 265 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.