Gene Page: RARB
Summary ?
GeneID | 5915 |
Symbol | RARB |
Synonyms | HAP|MCOPS12|NR1B2|RRB2 |
Description | retinoic acid receptor beta |
Reference | MIM:180220|HGNC:HGNC:9865|Ensembl:ENSG00000077092|HPRD:07183|Vega:OTTHUMG00000130480 |
Gene type | protein-coding |
Map location | 3p24.2 |
Pascal p-value | 0.007 |
Fetal beta | -3.078 |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NUDT1 | 0.75 | 0.56 |
MED30 | 0.72 | 0.56 |
H2AFY2 | 0.72 | 0.44 |
HAUS1 | 0.71 | 0.58 |
LEMD1 | 0.71 | 0.50 |
HAUS4 | 0.71 | 0.63 |
DCAF13 | 0.71 | 0.45 |
C17orf45 | 0.70 | 0.58 |
TMSB10 | 0.70 | 0.56 |
RUVBL1 | 0.70 | 0.51 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
CCNI2 | -0.42 | -0.55 |
RAPGEF4 | -0.42 | -0.60 |
PK4P | -0.42 | -0.55 |
OSBPL1A | -0.41 | -0.60 |
ASPHD1 | -0.41 | -0.47 |
COBL | -0.41 | -0.61 |
GAS2L1 | -0.41 | -0.47 |
EPB49 | -0.41 | -0.51 |
SPARCL1 | -0.41 | -0.51 |
BCL2L2 | -0.41 | -0.56 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004872 | receptor activity | IEA | - | |
GO:0003700 | transcription factor activity | IEA | - | |
GO:0003707 | steroid hormone receptor activity | IEA | - | |
GO:0003708 | retinoic acid receptor activity | IDA | 2177841 | |
GO:0003708 | retinoic acid receptor activity | IEA | - | |
GO:0003708 | retinoic acid receptor activity | TAS | 2833708 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IDA | 2177841 | |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
GO:0007165 | signal transduction | TAS | 2833708 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005575 | cellular_component | ND | - | |
GO:0005634 | nucleus | IDA | 2177841 | |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG SMALL CELL LUNG CANCER | 84 | 67 | All SZGR 2.0 genes in this pathway |
KEGG NON SMALL CELL LUNG CANCER | 54 | 47 | All SZGR 2.0 genes in this pathway |
PID RXR VDR PATHWAY | 26 | 24 | All SZGR 2.0 genes in this pathway |
PID RETINOIC ACID PATHWAY | 30 | 23 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
ZIRN TRETINOIN RESPONSE WT1 UP | 23 | 14 | All SZGR 2.0 genes in this pathway |
ZIRN TRETINOIN RESPONSE UP | 21 | 13 | All SZGR 2.0 genes in this pathway |
MARKS HDAC TARGETS UP | 23 | 15 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
XU HGF TARGETS REPRESSED BY AKT1 DN | 95 | 58 | All SZGR 2.0 genes in this pathway |
XU AKT1 TARGETS 48HR | 9 | 6 | All SZGR 2.0 genes in this pathway |
HATADA METHYLATED IN LUNG CANCER UP | 390 | 236 | All SZGR 2.0 genes in this pathway |
OHM METHYLATED IN ADULT CANCERS | 27 | 23 | All SZGR 2.0 genes in this pathway |
OHM EMBRYONIC CARCINOMA DN | 8 | 6 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS MODERATELY UP | 109 | 69 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC TARGETS WITH EBOX | 230 | 156 | All SZGR 2.0 genes in this pathway |
NOUZOVA METHYLATED IN APL | 68 | 39 | All SZGR 2.0 genes in this pathway |
NOUZOVA TRETINOIN AND H4 ACETYLATION | 143 | 85 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
WEIGEL OXIDATIVE STRESS BY HNE AND TBH | 60 | 42 | All SZGR 2.0 genes in this pathway |
MOREIRA RESPONSE TO TSA DN | 18 | 16 | All SZGR 2.0 genes in this pathway |
YIH RESPONSE TO ARSENITE C3 | 36 | 24 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS DN | 314 | 188 | All SZGR 2.0 genes in this pathway |
LOPES METHYLATED IN COLON CANCER UP | 27 | 20 | All SZGR 2.0 genes in this pathway |
KONDO PROSTATE CANCER HCP WITH H3K27ME3 | 97 | 72 | All SZGR 2.0 genes in this pathway |
HOQUE METHYLATED IN CANCER | 56 | 45 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
MATZUK SPERMATOCYTE | 72 | 55 | All SZGR 2.0 genes in this pathway |
SHARMA PILOCYTIC ASTROCYTOMA LOCATION UP | 25 | 12 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
LI PROSTATE CANCER EPIGENETIC | 30 | 22 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA CLASSES DN | 210 | 141 | All SZGR 2.0 genes in this pathway |
CAIRO LIVER DEVELOPMENT UP | 166 | 105 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
CARD MIR302A TARGETS | 77 | 62 | All SZGR 2.0 genes in this pathway |
KATSANOU ELAVL1 TARGETS UP | 169 | 105 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR TARGETS UP | 48 | 33 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 22 | 28 | m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-101 | 362 | 368 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-130/301 | 664 | 670 | 1A | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-133 | 121 | 127 | 1A | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
miR-135 | 879 | 885 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-141/200a | 850 | 857 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-144 | 1257 | 1263 | m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG | ||||
miR-146 | 1135 | 1142 | 1A,m8 | hsa-miR-146a | UGAGAACUGAAUUCCAUGGGUU |
hsa-miR-146bbrain | UGAGAACUGAAUUCCAUAGGCU | ||||
miR-15/16/195/424/497 | 78 | 84 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-17-5p/20/93.mr/106/519.d | 743 | 749 | 1A | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-203.1 | 213 | 219 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-29 | 373 | 379 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-30-3p | 95 | 102 | 1A,m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
miR-30-5p | 864 | 870 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG | ||||
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-34/449 | 697 | 703 | 1A | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-376c | 1246 | 1252 | m8 | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.