Gene Page: SMAP1
Summary ?
GeneID | 60682 |
Symbol | SMAP1 |
Synonyms | SMAP-1 |
Description | small ArfGAP 1 |
Reference | MIM:611372|HGNC:HGNC:19651|Ensembl:ENSG00000112305|HPRD:18072|Vega:OTTHUMG00000014996 |
Gene type | protein-coding |
Map location | 6q13 |
Pascal p-value | 0.15 |
Sherlock p-value | 9.269E-4 |
Fetal beta | 0.478 |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008270 | zinc ion binding | IEA | - | |
GO:0008060 | ARF GTPase activator activity | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0032312 | regulation of ARF GTPase activity | IEA | - | |
GO:0045648 | positive regulation of erythrocyte differentiation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ENDOCYTOSIS | 183 | 132 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
MCCLUNG CREB1 TARGETS UP | 100 | 72 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 17 | 181 | 101 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
IKEDA MIR1 TARGETS UP | 53 | 39 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 2 TRANSIENTLY INDUCED BY EGF | 51 | 29 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 37 | 43 | m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-10 | 688 | 695 | 1A,m8 | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
hsa-miR-10b | UACCCUGUAGAACCGAAUUUGU | ||||
miR-130/301 | 674 | 680 | 1A | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-181 | 429 | 435 | 1A | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-193 | 375 | 381 | 1A | hsa-miR-193a | AACUGGCCUACAAAGUCCCAG |
hsa-miR-193b | AACUGGCCCUCAAAGUCCCGCUUU | ||||
miR-22 | 202 | 208 | m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
miR-320 | 204 | 210 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-339 | 523 | 529 | 1A | hsa-miR-339 | UCCCUGUCCUCCAGGAGCUCA |
miR-496 | 431 | 437 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.