SZGR2

Summary ?

GeneID	60682
Symbol	SMAP1
Synonyms	SMAP-1
Description	small ArfGAP 1
Reference	MIM:611372\|HGNC:HGNC:19651\|Ensembl:ENSG00000112305\|HPRD:18072\|Vega:OTTHUMG00000014996
Gene type	protein-coding
Map location	6q13
Pascal p-value	0.15
Sherlock p-value	9.269E-4
Fetal beta	0.478
eGene	Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008270	zinc ion binding	IEA		-
GO:0008060	ARF GTPase activator activity	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0032312	regulation of ARF GTPase activity	IEA		-
GO:0045648	positive regulation of erythrocyte differentiation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005886	plasma membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ENDOCYTOSIS	183	132	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR	544	307	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS UP	100	72	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP	518	299	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 17	181	101	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE	317	190	All SZGR 2.0 genes in this pathway
IKEDA MIR1 TARGETS UP	53	39	All SZGR 2.0 genes in this pathway
ZWANG CLASS 2 TRANSIENTLY INDUCED BY EGF	51	29	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	37	43	m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-10	688	695	1A,m8	hsa-miR-10a	UACCCUGUAGAUCCGAAUUUGUG
miR-10	688	695	1A,m8	hsa-miR-10b	UACCCUGUAGAACCGAAUUUGU
miR-130/301	674	680	1A	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-181	429	435	1A	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-193	375	381	1A	hsa-miR-193a	AACUGGCCUACAAAGUCCCAG
miR-193	375	381	1A	hsa-miR-193b	AACUGGCCCUCAAAGUCCCGCUUU
miR-22	202	208	m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-320	204	210	m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-339	523	529	1A	hsa-miR-339	UCCCUGUCCUCCAGGAGCUCA
miR-496	431	437	1A	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SMAP1