SZGR2

Summary ?

GeneID	6304
Symbol	SATB1
Synonyms	-
Description	SATB homeobox 1
Reference	MIM:602075\|HGNC:HGNC:10541\|Ensembl:ENSG00000182568\|HPRD:03647\|Vega:OTTHUMG00000129890
Gene type	protein-coding
Map location	3p23
Pascal p-value	0.012
Fetal beta	-0.293
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	Chromatin Remodeling Genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Montano_2016	Genome-wide DNA methylation analysis	This dataset includes 172 replicated associations between CpGs with schizophrenia.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.006
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg00390724	3	18484742	SATB1	1.22E-4	-0.013	0.132	DMG:Montano_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs17620588	chr14	83609678	SATB1	6304		0.16		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PILRB	0.88	0.90
MAN2C1	0.85	0.84
CPT1B	0.84	0.88
AP1G2	0.84	0.90
LIME1	0.83	0.83
IDUA	0.82	0.80
ACCN3	0.82	0.84
RHOT2	0.81	0.77
LRCH4	0.81	0.80
HSF4	0.81	0.80

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
GIMAP4	-0.38	-0.36
CAPZA2	-0.37	-0.41
DNAJB9	-0.36	-0.40
GMFB	-0.36	-0.37
ELTD1	-0.36	-0.31
ITM2A	-0.36	-0.36
PNPLA8	-0.36	-0.40
RAP1A	-0.35	-0.39
TM4SF18	-0.34	-0.29
MOBKL3	-0.33	-0.34

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003690	double-stranded DNA binding	TAS		1505028
GO:0003700	transcription factor activity	IEA		-
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000122	negative regulation of transcription from RNA polymerase II promoter	IMP		15851481
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006325	establishment or maintenance of chromatin architecture	IEA		-
GO:0006325	establishment or maintenance of chromatin architecture	TAS		1505028
GO:0016571	histone methylation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005634	nucleus	TAS		1505028
GO:0005720	nuclear heterochromatin	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BAZ1A	ACF1 \| DKFZp586E0518 \| FLJ14383 \| WALp1 \| WCRF180 \| hACF1	bromodomain adjacent to zinc finger domain, 1A	Co-fractionation Reconstituted Complex	BioGRID	12374985
CHD3	Mi-2a \| Mi2-ALPHA \| ZFH	chromodomain helicase DNA binding protein 3	-	HPRD	12374985
CHD4	DKFZp686E06161 \| Mi-2b \| Mi2-BETA	chromodomain helicase DNA binding protein 4	Affinity Capture-Western Co-fractionation	BioGRID	12374985
CUX1	CASP \| CDP \| CDP/Cut \| CDP1 \| COY1 \| CUTL1 \| CUX \| Clox \| Cux/CDP \| GOLIM6 \| Nbla10317 \| p100 \| p110 \| p200 \| p75	cut-like homeobox 1	-	HPRD,BioGRID	10373541
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	-	HPRD,BioGRID	12374985
HDAC2	RPD3 \| YAF1	histone deacetylase 2	Co-fractionation	BioGRID	12374985
MTA2	DKFZp686F2281 \| MTA1L1 \| PID	metastasis associated 1 family, member 2	-	HPRD,BioGRID	12374985
POLR2J	MGC71910 \| POLR2J1 \| RPB11 \| RPB11A \| RPB11m \| hRPB14	polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa	Reconstituted Complex Two-hybrid	BioGRID	12036295
SATB1	-	SATB homeobox 1	-	HPRD	12374985
SIN3A	DKFZp434K2235 \| FLJ90319 \| KIAA0700	SIN3 homolog A, transcription regulator (yeast)	Co-fractionation	BioGRID	12374985
SMARCA5	ISWI \| SNF2H \| WCRF135 \| hISWI \| hSNF2H	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	-	HPRD,BioGRID	12374985
UBE2I	C358B7.1 \| P18 \| UBC9	ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	Two-hybrid	BioGRID	16189514

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID CASPASE PATHWAY	52	39	All SZGR 2.0 genes in this pathway
REACTOME APOPTOTIC CLEAVAGE OF CELLULAR PROTEINS	40	26	All SZGR 2.0 genes in this pathway
REACTOME APOPTOSIS	148	94	All SZGR 2.0 genes in this pathway
REACTOME APOPTOTIC EXECUTION PHASE	54	37	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
HOLLMANN APOPTOSIS VIA CD40 DN	267	178	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN	116	79	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER DN	406	230	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL UP	95	64	All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS UP	456	228	All SZGR 2.0 genes in this pathway
ODONNELL TARGETS OF MYC AND TFRC UP	83	50	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN	329	219	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN UP	177	113	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
LUI THYROID CANCER PAX8 PPARG UP	44	29	All SZGR 2.0 genes in this pathway
STREICHER LSM1 TARGETS UP	44	34	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 12HR	43	35	All SZGR 2.0 genes in this pathway
LUI THYROID CANCER CLUSTER 1	51	33	All SZGR 2.0 genes in this pathway
AIYAR COBRA1 TARGETS UP	39	25	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN	164	111	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING VIA SMAD4 UP	108	66	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS B LYMPHOCYTE DN	38	25	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP	151	100	All SZGR 2.0 genes in this pathway
POMEROY MEDULLOBLASTOMA PROGNOSIS UP	47	30	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER MYC DN	63	40	All SZGR 2.0 genes in this pathway
GUO HEX TARGETS UP	81	54	All SZGR 2.0 genes in this pathway
WANG IMMORTALIZED BY HOXA9 AND MEIS1 DN	24	15	All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION	405	264	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP	268	157	All SZGR 2.0 genes in this pathway
CARDOSO RESPONSE TO GAMMA RADIATION AND 3AB	18	11	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN T LYMPHOCYTE DN	37	29	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
MOLENAAR TARGETS OF CCND1 AND CDK4 UP	67	48	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 UP	295	149	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER NORMAL LIKE UP	476	285	All SZGR 2.0 genes in this pathway
RAY TARGETS OF P210 BCR ABL FUSION DN	16	11	All SZGR 2.0 genes in this pathway
CHANG CORE SERUM RESPONSE DN	209	137	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN	435	289	All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE	200	115	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
MCMURRAY TP53 HRAS COOPERATION RESPONSE DN	67	46	All SZGR 2.0 genes in this pathway
ELLWOOD MYC TARGETS DN	40	27	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3	142	103	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP	442	263	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE DN	181	97	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 9 11 TRANSLOCATION	130	87	All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT UP	166	105	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA PR DN	44	34	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3	210	148	All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER DN	116	83	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS DN	115	73	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN	321	200	All SZGR 2.0 genes in this pathway
IKEDA MIR30 TARGETS UP	116	87	All SZGR 2.0 genes in this pathway
HUANG GATA2 TARGETS UP	149	96	All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN	308	187	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-137	873	879	m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-153	909	915	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-153	909	915	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-155	334	340	m8	hsa-miR-155	UUAAUGCUAAUCGUGAUAGGGG
miR-18	962	968	1A	hsa-miR-18a	UAAGGUGCAUCUAGUGCAGAUA
miR-18	962	968	1A	hsa-miR-18b	UAAGGUGCAUCUAGUGCAGUUA
miR-186	1155	1161	1A	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-19	123	129	1A	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	123	129	1A	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-194	1118	1124	1A	hsa-miR-194	UGUAACAGCAACUCCAUGUGGA
miR-208	804	810	1A	hsa-miR-208	AUAAGACGAGCAAAAAGCUUGU
miR-21	933	939	m8	hsa-miR-21^brain	UAGCUUAUCAGACUGAUGUUGA
miR-21	933	939	m8	hsa-miR-590	GAGCUUAUUCAUAAAAGUGCAG
miR-219	1028	1034	1A	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-23	640	647	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
				hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-30-5p	1024	1030	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-323	640	646	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-323	640	646	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-34/449	539	545	m8	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-376	1100	1106	1A	hsa-miR-376a	AUCAUAGAGGAAAAUCCACGU
miR-376	1100	1106	1A	hsa-miR-376b	AUCAUAGAGGAAAAUCCAUGUU
miR-376c	861	867	m8	hsa-miR-376c	AACAUAGAGGAAAUUCCACG
miR-381	525	531	m8	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-448	975	981	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-448	975	981	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-485-5p	323	329	1A	hsa-miR-485-5p	AGAGGCUGGCCGUGAUGAAUUC
miR-495	1116	1122	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-495	1116	1122	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-499	804	810	1A	hsa-miR-499	UUAAGACUUGCAGUGAUGUUUAA
miR-544	1162	1169	1A,m8	hsa-miR-544	AUUCUGCAUUUUUAGCAAGU
miR-7	1013	1019	m8	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SATB1