Gene Page: SCN4B
Summary ?
| GeneID | 6330 |
| Symbol | SCN4B |
| Synonyms | ATFB17|LQT10|Navbeta4 |
| Description | sodium voltage-gated channel beta subunit 4 |
| Reference | MIM:608256|HGNC:HGNC:10592|Ensembl:ENSG00000177098|HPRD:09749|Vega:OTTHUMG00000166994 |
| Gene type | protein-coding |
| Map location | 11q23.3 |
| Pascal p-value | 0.083 |
| Sherlock p-value | 0.577 |
| Fetal beta | -2.949 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans Meta |
| Support | EXCITABILITY |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg22939802 | 11 | 118024134 | SCN4B | 8.49E-5 | -0.218 | 0.026 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs3109303 | chr2 | 130355505 | SCN4B | 6330 | 0.05 | trans | ||
| rs10510196 | chr3 | 723427 | SCN4B | 6330 | 0.06 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005244 | voltage-gated ion channel activity | IEA | - | |
| GO:0005248 | voltage-gated sodium channel activity | IDA | 12930796 | |
| GO:0031402 | sodium ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006814 | sodium ion transport | IDA | 12930796 | |
| GO:0006811 | ion transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0001518 | voltage-gated sodium channel complex | IDA | 12930796 | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| TURASHVILI BREAST DUCTAL CARCINOMA VS DUCTAL NORMAL DN | 198 | 110 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP | 194 | 122 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
| CERVERA SDHB TARGETS 1 UP | 118 | 66 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
| YANG BCL3 TARGETS UP | 364 | 236 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 1239 | 1245 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 1238 | 1245 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-125/351 | 1062 | 1069 | 1A,m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
| hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
| miR-15/16/195/424/497 | 97 | 103 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-19 | 1207 | 1214 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-490 | 3326 | 3332 | m8 | hsa-miR-490 | CAACCUGGAGGACUCCAUGCUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.