Gene Page: SDCBP
Summary ?
GeneID | 6386 |
Symbol | SDCBP |
Synonyms | MDA-9|MDA9|ST1|SYCL|TACIP18 |
Description | syndecan binding protein |
Reference | MIM:602217|HGNC:HGNC:10662|Ensembl:ENSG00000137575|HPRD:03741|Vega:OTTHUMG00000164303 |
Gene type | protein-coding |
Map location | 8q12 |
Pascal p-value | 0.561 |
Sherlock p-value | 0.16 |
Fetal beta | 1.285 |
DMG | 1 (# studies) |
eGene | Cerebellum Frontal Cortex BA9 Meta |
Support | Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 1.0012 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg02103294 | 8 | 59465971 | SDCBP | -0.026 | 0.25 | DMG:Nishioka_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](/SZGR/GeneImg/SDCBP_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C6orf167 | 0.92 | 0.80 |
DTL | 0.91 | 0.67 |
TIMELESS | 0.90 | 0.80 |
MCM2 | 0.90 | 0.79 |
CDK2 | 0.89 | 0.52 |
MCM10 | 0.89 | 0.61 |
BRCA2 | 0.89 | 0.59 |
MCM5 | 0.89 | 0.76 |
RRM2 | 0.89 | 0.61 |
FAM83D | 0.89 | 0.75 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C5orf53 | -0.41 | -0.62 |
PTH1R | -0.40 | -0.63 |
SLC9A3R2 | -0.40 | -0.35 |
SLC16A11 | -0.39 | -0.49 |
LGI4 | -0.38 | -0.36 |
AIFM3 | -0.38 | -0.56 |
HLA-F | -0.38 | -0.54 |
TNFSF12 | -0.38 | -0.52 |
FXYD7 | -0.38 | -0.33 |
TMEM54 | -0.38 | -0.48 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005137 | interleukin-5 receptor binding | ISS | 11498591 | |
GO:0005515 | protein binding | IEA | - | |
GO:0008093 | cytoskeletal adaptor activity | NAS | 9391086 | |
GO:0016491 | oxidoreductase activity | IEA | - | |
GO:0045545 | syndecan binding | NAS | 9391086 | |
GO:0047485 | protein N-terminus binding | IPI | 15371445 | |
GO:0046982 | protein heterodimerization activity | IPI | 11152476 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007268 | synaptic transmission | NAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 9883737 |
GO:0007265 | Ras protein signal transduction | IEA | - | |
GO:0007242 | intracellular signaling cascade | NAS | 9391086 | |
GO:0008152 | metabolic process | IEA | - | |
GO:0006930 | substrate-bound cell migration, cell extension | NAS | 12037664 | |
GO:0006612 | protein targeting to membrane | NAS | 10230395 | |
GO:0030036 | actin cytoskeleton organization | NAS | 12037664 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005856 | cytoskeleton | NAS | 9391086 | |
GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
GO:0005634 | nucleus | NAS | 11179419 | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0005912 | adherens junction | NAS | 11179419 | |
GO:0005895 | interleukin-5 receptor complex | ISS | 11498591 | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0042470 | melanosome | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
CADM1 | BL2 | DKFZp686F1789 | IGSF4 | IGSF4A | MGC149785 | MGC51880 | NECL2 | Necl-2 | RA175 | ST17 | SYNCAM | TSLC1 | sTSLC-1 | sgIGSF | synCAM1 | cell adhesion molecule 1 | - | HPRD,BioGRID | 12202822 |
EFNB1 | CFND | CFNS | EFL3 | EPLG2 | Elk-L | LERK2 | MGC8782 | ephrin-B1 | - | HPRD,BioGRID | 9920925 |
EFNB2 | EPLG5 | HTKL | Htk-L | LERK5 | MGC126226 | MGC126227 | MGC126228 | ephrin-B2 | Ephrin-B2 interacts with ST-1. This interaction was modelled on a demonstrated interaction between human Ephrin-B2 and rat ST-1. | BIND | 11152476 |
EFNB2 | EPLG5 | HTKL | Htk-L | LERK5 | MGC126226 | MGC126227 | MGC126228 | ephrin-B2 | - | HPRD | 10473577 |
EPHA7 | EHK3 | HEK11 | EPH receptor A7 | EphA7 interacts with ST-1. This interaction was modelled on a demonstrated interaction between human EphA7 and rat ST-1. | BIND | 11152476 |
GRIA1 | GLUH1 | GLUR1 | GLURA | HBGR1 | MGC133252 | glutamate receptor, ionotropic, AMPA 1 | - | HPRD,BioGRID | 11891216 |
GRIA2 | GLUR2 | GLURB | GluR-K2 | HBGR2 | glutamate receptor, ionotropic, AMPA 2 | Reconstituted Complex | BioGRID | 11891216 |
GRIA3 | GLUR-C | GLUR-K3 | GLUR3 | GLURC | MRX94 | glutamate receptor, ionotrophic, AMPA 3 | Reconstituted Complex | BioGRID | 11891216 |
GRIA4 | GLUR4 | GLUR4C | GLURD | glutamate receptor, ionotrophic, AMPA 4 | - | HPRD,BioGRID | 11891216 |
GRIK1 | EAA3 | EEA3 | GLR5 | GLUR5 | glutamate receptor, ionotropic, kainate 1 | - | HPRD,BioGRID | 12597860 |
GRIK2 | EAA4 | GLR6 | GLUK6 | GLUR6 | MGC74427 | MRT6 | glutamate receptor, ionotropic, kainate 2 | - | HPRD,BioGRID | 12597860 |
GRIK3 | EAA5 | GLR7 | GLUR7 | GluR7a | glutamate receptor, ionotropic, kainate 3 | Reconstituted Complex | BioGRID | 11891216 |
GRM3 | GLUR3 | GPRC1C | MGLUR3 | mGlu3 | glutamate receptor, metabotropic 3 | - | HPRD,BioGRID | 11891216 |
GRM7 | FLJ40498 | GLUR7 | GPRC1G | MGLUR7 | mGlu7 | glutamate receptor, metabotropic 7 | Syntenin interacts with mGluR7b. This interaction was modeled on a demonstrated interaction between GRIP from an unspecified species and human mGluR7b. | BIND | 11891216 |
IL5RA | CD125 | CDw125 | HSIL5R3 | IL5R | MGC26560 | interleukin 5 receptor, alpha | - | HPRD,BioGRID | 11498591 |
NF2 | ACN | BANF | SCH | neurofibromin 2 (merlin) | Schwannomin interacts with syntenin. | BIND | 11432873 |
NF2 | ACN | BANF | SCH | neurofibromin 2 (merlin) | - | HPRD,BioGRID | 11432873 |
NFASC | DKFZp686P2250 | FLJ46866 | KIAA0756 | NF | NRCAML | neurofascin homolog (chicken) | - | HPRD | 11152476 |
NRXN1 | DKFZp313P2036 | FLJ35941 | Hs.22998 | KIAA0578 | neurexin 1 | Neurexin I-alpha interacts with ST-1. This interaction was modelled on a demonstrated interaction between human neurexin I-alpha and rat ST-1. | BIND | 11152476 |
PTPRJ | CD148 | DEP1 | HPTPeta | R-PTP-ETA | SCC1 | protein tyrosine phosphatase, receptor type, J | - | HPRD,BioGRID | 12403354 |
RAB5A | RAB5 | RAB5A, member RAS oncogene family | Affinity Capture-Western Two-hybrid | BioGRID | 15014045 |
SDC1 | CD138 | SDC | SYND1 | syndecan | syndecan 1 | - | HPRD,BioGRID | 11179419 |
SDC2 | HSPG | HSPG1 | SYND2 | syndecan 2 | - | HPRD,BioGRID | 9391086 |
SDC3 | N-syndecan | SDCN | SYND3 | syndecan 3 | Syndecan-3 interacts with ST-1. This interaction was modelled on a demonstrated interaction between human syndecan-3 and rat ST-1. | BIND | 11152476 |
SDC4 | MGC22217 | SYND4 | syndecan 4 | - | HPRD | 12241528 |
SDCBP2 | FLJ12256 | SITAC18 | ST-2 | syndecan binding protein (syntenin) 2 | - | HPRD | 11152476 |
SOX4 | EVI16 | SRY (sex determining region Y)-box 4 | - | HPRD,BioGRID | 11498591 |
TGFA | TFGA | transforming growth factor, alpha | Pro-TGF-alpha interacts with ST-1. This interaction was modelled on a demonstrated interaction between human Pro-TGF-alpha and rat ST-1. | BIND | 11152476 |
ULK1 | ATG1 | FLJ38455 | UNC51 | Unc51.1 | unc-51-like kinase 1 (C. elegans) | - | HPRD,BioGRID | 15014045 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID IL5 PATHWAY | 14 | 11 | All SZGR 2.0 genes in this pathway |
PID SYNDECAN 4 PATHWAY | 32 | 25 | All SZGR 2.0 genes in this pathway |
PID SYNDECAN 1 PATHWAY | 46 | 29 | All SZGR 2.0 genes in this pathway |
PID SYNDECAN 2 PATHWAY | 33 | 27 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME L1CAM INTERACTIONS | 86 | 62 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
LAIHO COLORECTAL CANCER SERRATED UP | 112 | 71 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2A DN | 141 | 84 | All SZGR 2.0 genes in this pathway |
OUELLET OVARIAN CANCER INVASIVE VS LMP UP | 117 | 85 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
FERREIRA EWINGS SARCOMA UNSTABLE VS STABLE UP | 167 | 92 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP | 176 | 115 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 8Q12 Q22 AMPLICON | 132 | 82 | All SZGR 2.0 genes in this pathway |
DER IFN ALPHA RESPONSE UP | 74 | 48 | All SZGR 2.0 genes in this pathway |
DORSAM HOXA9 TARGETS DN | 32 | 22 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
DER IFN GAMMA RESPONSE UP | 71 | 45 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS MATURE CELL | 293 | 160 | All SZGR 2.0 genes in this pathway |
WANG CISPLATIN RESPONSE AND XPC DN | 228 | 146 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
ZHENG FOXP3 TARGETS IN THYMUS UP | 196 | 137 | All SZGR 2.0 genes in this pathway |
SARRIO EPITHELIAL MESENCHYMAL TRANSITION DN | 154 | 101 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
ALONSO METASTASIS EMT UP | 36 | 24 | All SZGR 2.0 genes in this pathway |
ALONSO METASTASIS NEURAL UP | 18 | 13 | All SZGR 2.0 genes in this pathway |
ALONSO METASTASIS UP | 198 | 128 | All SZGR 2.0 genes in this pathway |
CROONQUIST NRAS SIGNALING UP | 41 | 24 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
DORN ADENOVIRUS INFECTION 12HR DN | 33 | 25 | All SZGR 2.0 genes in this pathway |
DORN ADENOVIRUS INFECTION 24HR DN | 43 | 32 | All SZGR 2.0 genes in this pathway |
DORN ADENOVIRUS INFECTION 32HR DN | 39 | 28 | All SZGR 2.0 genes in this pathway |
DORN ADENOVIRUS INFECTION 48HR DN | 40 | 29 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 9 | 76 | 45 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
ALFANO MYC TARGETS | 239 | 156 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE VIA P38 COMPLETE | 227 | 151 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 497 | 503 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-124.1 | 592 | 598 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-135 | 279 | 285 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-142-5p | 1036 | 1042 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-155 | 508 | 515 | 1A,m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
miR-17-5p/20/93.mr/106/519.d | 1035 | 1041 | 1A | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-196 | 562 | 568 | m8 | hsa-miR-196a | UAGGUAGUUUCAUGUUGUUGG |
hsa-miR-196b | UAGGUAGUUUCCUGUUGUUGG | ||||
miR-496 | 837 | 843 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.