Gene Page: SYN1
Summary ?
| GeneID | 6853 |
| Symbol | SYN1 |
| Synonyms | SYN1a|SYN1b|SYNI |
| Description | synapsin I |
| Reference | MIM:313440|HGNC:HGNC:11494|Ensembl:ENSG00000008056|HPRD:02433|Vega:OTTHUMG00000021454 |
| Gene type | protein-coding |
| Map location | Xp11.23 |
| Fetal beta | -1.521 |
| Support | CANABINOID DOPAMINE EXOCYTOSIS METABOTROPIC GLUTAMATE RECEPTOR SEROTONIN G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_Synaptosome CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003824 | catalytic activity | IEA | - | |
| GO:0003779 | actin binding | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0005215 | transporter activity | TAS | 2110562 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007269 | neurotransmitter secretion | IEA | neuron, axon, Synap, serotonin, Neurotransmitter, dopamine (GO term level: 8) | - |
| GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 2110562 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008021 | synaptic vesicle | IEA | Synap, Neurotransmitter (GO term level: 12) | - |
| GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005634 | nucleus | IDA | 18029348 | |
| GO:0005737 | cytoplasm | IDA | 18029348 | |
| GO:0030054 | cell junction | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| AMPH | AMPH1 | amphiphysin | - | HPRD,BioGRID | 10899172 |
| BIN1 | AMPH2 | AMPHL | DKFZp547F068 | MGC10367 | SH3P9 | bridging integrator 1 | - | HPRD,BioGRID | 10899172 |
| CRK | CRKII | v-crk sarcoma virus CT10 oncogene homolog (avian) | - | HPRD,BioGRID | 10899172 |
| GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD | 8022809 |
| GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD,BioGRID | 8022809|10899172 |
| KAT5 | ESA1 | HTATIP | HTATIP1 | PLIP | TIP | TIP60 | cPLA2 | K(lysine) acetyltransferase 5 | Two-hybrid | BioGRID | 16169070 |
| NCF1 | FLJ79451 | NCF1A | NOXO2 | SH3PXD1A | p47phox | neutrophil cytosolic factor 1 | in vivo | BioGRID | 10899172 |
| NCF1C | SH3PXD1C | neutrophil cytosolic factor 1C pseudogene | - | HPRD | 10899172 |
| NOS1 | IHPS1 | NOS | nNOS | nitric oxide synthase 1 (neuronal) | Reconstituted Complex | BioGRID | 11867766 |
| NOS1AP | 6330408P19Rik | CAPON | MGC138500 | nitric oxide synthase 1 (neuronal) adaptor protein | - | HPRD,BioGRID | 11867766 |
| PFN2 | D3S1319E | PFL | profilin 2 | - | HPRD | 9463375 |
| PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | - | HPRD,BioGRID | 10899172 |
| PLCG1 | PLC-II | PLC1 | PLC148 | PLCgamma1 | phospholipase C, gamma 1 | - | HPRD | 10899172 |
| RASA1 | CM-AVM | CMAVM | DKFZp434N071 | GAP | PKWS | RASA | RASGAP | p120GAP | p120RASGAP | RAS p21 protein activator (GTPase activating protein) 1 | - | HPRD,BioGRID | 10899172 |
| SH3GL2 | CNSA2 | EEN-B1 | FLJ20276 | FLJ25015 | SH3D2A | SH3P4 | SH3-domain GRB2-like 2 | Reconstituted Complex | BioGRID | 12456676 |
| SPTAN1 | (ALPHA)II-SPECTRIN | FLJ44613 | NEAS | spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) | - | HPRD | 1905928 |
| SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | - | HPRD,BioGRID | 10899172 |
| SYN1 | SYN1a | SYN1b | SYNI | synapsin I | Two-hybrid | BioGRID | 16169070 |
| SYN2 | SYNII | SYNIIa | SYNIIb | synapsin II | - | HPRD,BioGRID | 10358015 |
| SYN3 | - | synapsin III | - | HPRD | 10358015 |
| VIM | FLJ36605 | vimentin | Two-hybrid | BioGRID | 16169070 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES | 186 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
| REACTOME NEUROTRANSMITTER RELEASE CYCLE | 34 | 30 | All SZGR 2.0 genes in this pathway |
| REACTOME DOPAMINE NEUROTRANSMITTER RELEASE CYCLE | 11 | 11 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| LI AMPLIFIED IN LUNG CANCER | 178 | 108 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| KEEN RESPONSE TO ROSIGLITAZONE DN | 106 | 68 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
| VART KSHV INFECTION ANGIOGENIC MARKERS UP | 165 | 118 | All SZGR 2.0 genes in this pathway |
| HUNSBERGER EXERCISE REGULATED GENES | 31 | 26 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-153 | 665 | 671 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| miR-19 | 696 | 703 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-448 | 664 | 671 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
| miR-452 | 667 | 673 | m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
| miR-539 | 58 | 65 | 1A,m8 | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.