Gene Page: SYP
Summary ?
| GeneID | 6855 |
| Symbol | SYP |
| Synonyms | MRX96|MRXSYP |
| Description | synaptophysin |
| Reference | MIM:313475|HGNC:HGNC:11506|Ensembl:ENSG00000102003|HPRD:02435|Vega:OTTHUMG00000034557 |
| Gene type | protein-coding |
| Map location | Xp11.23-p11.22 |
| Sherlock p-value | 0.81 |
| Fetal beta | -2.266 |
| Support | EXOCYTOSIS SEROTONIN G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Potential synaptic genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 6 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| POLD2 | 0.94 | 0.95 |
| PPP4C | 0.92 | 0.94 |
| CLPP | 0.92 | 0.92 |
| PTOV1 | 0.92 | 0.92 |
| AP4M1 | 0.91 | 0.92 |
| MIIP | 0.91 | 0.93 |
| BCS1L | 0.91 | 0.92 |
| GNB2 | 0.91 | 0.92 |
| PRMT1 | 0.91 | 0.94 |
| TSEN34 | 0.91 | 0.91 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.27 | -0.71 | -0.82 |
| AF347015.33 | -0.71 | -0.84 |
| MT-CO2 | -0.69 | -0.80 |
| MT-CYB | -0.69 | -0.82 |
| AF347015.8 | -0.69 | -0.82 |
| AF347015.31 | -0.68 | -0.79 |
| AF347015.15 | -0.68 | -0.82 |
| AF347015.2 | -0.67 | -0.83 |
| AF347015.26 | -0.66 | -0.83 |
| HLA-F | -0.64 | -0.69 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005509 | calcium ion binding | NAS | - | |
| GO:0005515 | protein binding | NAS | 10620806 | |
| GO:0005215 | transporter activity | IEA | - | |
| GO:0015485 | cholesterol binding | IDA | 10620806 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016188 | synaptic vesicle maturation | NAS | Synap (GO term level: 8) | 10620806 |
| GO:0048499 | synaptic vesicle membrane organization | NAS | Synap (GO term level: 5) | 10620806 |
| GO:0006810 | transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0042734 | presynaptic membrane | IEA | neuron, axon, Synap (GO term level: 5) | - |
| GO:0008021 | synaptic vesicle | IEA | Synap, Neurotransmitter (GO term level: 12) | - |
| GO:0019717 | synaptosome | IEA | Synap, Brain (GO term level: 7) | - |
| GO:0030285 | integral to synaptic vesicle membrane | NAS | Synap (GO term level: 14) | 1975480 |
| GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
| GO:0030054 | cell junction | IEA | - | |
| GO:0031410 | cytoplasmic vesicle | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| MODY HIPPOCAMPUS POSTNATAL | 63 | 50 | All SZGR 2.0 genes in this pathway |
| WEIGEL OXIDATIVE STRESS BY HNE AND H2O2 | 39 | 29 | All SZGR 2.0 genes in this pathway |
| MCCLUNG COCAINE REWARD 5D | 79 | 62 | All SZGR 2.0 genes in this pathway |
| MCCLUNG CREB1 TARGETS UP | 100 | 72 | All SZGR 2.0 genes in this pathway |
| LEIN NEURON MARKERS | 69 | 45 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| FONTAINE FOLLICULAR THYROID ADENOMA DN | 68 | 45 | All SZGR 2.0 genes in this pathway |
| FONTAINE PAPILLARY THYROID CARCINOMA DN | 80 | 53 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES HCP WITH H3 UNMETHYLATED | 63 | 31 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3 UNMETHYLATED | 228 | 119 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-224 | 355 | 361 | m8 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
| miR-24 | 164 | 170 | m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.