Gene Page: TFAP2B
Summary ?
GeneID | 7021 |
Symbol | TFAP2B |
Synonyms | AP-2B|AP2-B |
Description | transcription factor AP-2 beta (activating enhancer binding protein 2 beta) |
Reference | MIM:601601|HGNC:HGNC:11743|Ensembl:ENSG00000008196|HPRD:03360|Vega:OTTHUMG00000014836 |
Gene type | protein-coding |
Map location | 6p12 |
Pascal p-value | 8.92E-4 |
Fetal beta | -0.095 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 3 |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg21317965 | 6 | 50803850 | TFAP2B | 1.71E-5 | -0.612 | 0.015 | DMG:Wockner_2014 |
cg08857063 | 6 | 50808667 | TFAP2B | 2.254E-4 | -0.255 | 0.036 | DMG:Wockner_2014 |
cg17083323 | 6 | 50803820 | TFAP2B | 4.28E-4 | -0.378 | 0.045 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IDA | 12169688 | |
GO:0003713 | transcription coactivator activity | TAS | 7555706 | |
GO:0043565 | sequence-specific DNA binding | IDA | 12169688 | |
GO:0046983 | protein dimerization activity | IDA | 12072434 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 7555706 |
GO:0001822 | kidney development | IEA | - | |
GO:0006357 | regulation of transcription from RNA polymerase II promoter | TAS | 7555706 | |
GO:0006350 | transcription | IEA | - | |
GO:0045817 | positive regulation of transcription from RNA polymerase II promoter, global | IDA | 12169688 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IC | 12169688 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST DUCTAL CARCINOMA VS DUCTAL NORMAL DN | 198 | 110 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
DOANE BREAST CANCER CLASSES UP | 72 | 38 | All SZGR 2.0 genes in this pathway |
JAEGER METASTASIS DN | 258 | 141 | All SZGR 2.0 genes in this pathway |
LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN DN | 172 | 112 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION DN | 48 | 31 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS LUMINAL | 326 | 213 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS BASAL | 330 | 217 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA UP | 98 | 64 | All SZGR 2.0 genes in this pathway |
LEE AGING MUSCLE UP | 45 | 33 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN LUNG DN | 37 | 22 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER ERBB2 UP | 147 | 83 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
BRUNEAU HEART GREAT VESSELS AND VALVULOGENESIS | 8 | 8 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 ICP WITH H3K27ME3 | 74 | 46 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF ICP WITH H3K27ME3 | 206 | 108 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS WITH HCP H3K27ME3 | 102 | 76 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS ICP WITH H3K27ME3 | 54 | 32 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES HCP WITH H3K27ME3 | 41 | 30 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
GREGORY SYNTHETIC LETHAL WITH IMATINIB | 145 | 83 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-137 | 3542 | 3548 | m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-141/200a | 4176 | 4183 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-142-5p | 4128 | 4134 | 1A | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-186 | 1130 | 1136 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU | ||||
hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU | ||||
miR-219 | 123 | 129 | 1A | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
miR-27 | 4065 | 4071 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-320 | 69 | 75 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-361 | 2917 | 2924 | 1A,m8 | hsa-miR-361brain | UUAUCAGAAUCUCCAGGGGUAC |
miR-381 | 3975 | 3981 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-505 | 2409 | 2415 | m8 | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.