SZGR2

Summary ?

GeneID	7273
Symbol	TTN
Synonyms	CMD1G\|CMH9\|CMPD4\|EOMFC\|HMERF\|LGMD2J\|MYLK5\|TMD
Description	titin
Reference	MIM:188840\|HGNC:HGNC:12403\|Ensembl:ENSG00000155657\|HPRD:01787\|Vega:OTTHUMG00000154448
Gene type	protein-coding
Map location	2q31
Pascal p-value	0.175
Fetal beta	-1.551
Support	CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
DNM:McCarthy_2014	Whole Exome Sequencing analysis	Whole exome sequencing of 57 trios with sporadic or familial schizophrenia.
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0863

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
TTN	chr2	179417060	G	A	NM_003319	p.L21124L	synonymous SNV			Schizophrenia	DNM:McCarthy_2014
TTN	chr2	179638834	C	T	NM_001256850 NM_001256850 NM_001267550 NM_001267550 NM_003319 NM_003319 NM_133378 NM_133378 NM_133379 NM_133379 NM_133432 NM_133432 NM_133437 NM_133437	. p.2354R>H . p.2354R>H . p.2308R>H . p.2354R>H . p.2354R>H . p.2308R>H . p.2308R>H	splice missense splice missense splice missense splice missense splice missense splice missense splice missense			Schizophrenia	DNM:Fromer_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TRAP1	0.88	0.87
CFL1	0.87	0.88
PPP2R1A	0.87	0.87
DCTN2	0.86	0.88
ARPC1A	0.86	0.86
KAT5	0.86	0.85
PSMD3	0.85	0.84
CCT5	0.84	0.86
AKR1B1	0.84	0.85
NOC2L	0.84	0.84

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.27	-0.76	-0.76
AF347015.31	-0.75	-0.74
AF347015.8	-0.74	-0.73
AF347015.33	-0.73	-0.74
MT-CO2	-0.73	-0.71
AF347015.21	-0.73	-0.76
MT-CYB	-0.73	-0.73
AF347015.2	-0.71	-0.71
AF347015.15	-0.71	-0.71
MT-ATP8	-0.68	-0.75

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005089	Rho guanyl-nucleotide exchange factor activity	IEA		-
GO:0004601	peroxidase activity	IEA		-
GO:0005516	calmodulin binding	TAS		10481174
GO:0005524	ATP binding	IEA		-
GO:0005524	ATP binding	TAS		9804419
GO:0004674	protein serine/threonine kinase activity	IDA		9804419
GO:0004674	protein serine/threonine kinase activity	IEA		-
GO:0004713	protein tyrosine kinase activity	IEA		-
GO:0004197	cysteine-type endopeptidase activity	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0020037	heme binding	IEA		-
GO:0008307	structural constituent of muscle	TAS		7569978
GO:0017022	myosin binding	TAS		11717165
GO:0042802	identical protein binding	IPI		9804419
GO:0051393	alpha-actinin binding	TAS		10481174
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0006508	proteolysis	IEA		-
GO:0005975	carbohydrate metabolic process	IEA		-
GO:0007067	mitosis	TAS		10481174
GO:0006979	response to oxidative stress	IEA		-
GO:0006941	striated muscle contraction	TAS		7569978
GO:0035023	regulation of Rho protein signal transduction	IEA		-
GO:0030239	myofibril assembly	IMP		9804419
GO:0046777	protein amino acid autophosphorylation	IMP		9804419
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000794	condensed nuclear chromosome	TAS		10481174
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0030017	sarcomere	TAS		7569978
GO:0030018	Z disc	IDA		9501083
GO:0030018	Z disc	TAS		8937992

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTN1	FLJ40884	actinin, alpha 1	-	HPRD,BioGRID	11305911 \|11846417
ANK1	ANK \| SPH1 \| SPH2	ankyrin 1, erythrocytic	-	HPRD,BioGRID	12444090
ANKRD1	ALRP \| C-193 \| CARP \| CVARP \| MCARP \| bA320F15.2	ankyrin repeat domain 1 (cardiac muscle)	-	HPRD,BioGRID	14583192
ANKRD2	ARPP \| MGC104314	ankyrin repeat domain 2 (stretch responsive muscle)	-	HPRD,BioGRID	14583192
ANKRD23	DARP \| FLJ32449 \| MARP3 \| MGC129593	ankyrin repeat domain 23	-	HPRD,BioGRID	14583192
ASF1B	CIA-II \| FLJ10604	ASF1 anti-silencing function 1 homolog B (S. cerevisiae)	Affinity Capture-MS	BioGRID	17353931
CALM1	CALML2 \| CAMI \| DD132 \| PHKD	calmodulin 1 (phosphorylase kinase, delta)	-	HPRD	11178895
CAPN3	CANP3 \| CANPL3 \| LGMD2 \| LGMD2A \| MGC10767 \| MGC11121 \| MGC14344 \| MGC4403 \| nCL-1 \| p94	calpain 3, (p94)	-	HPRD	8537379 \|9642272\|9185618 \|9763216 \|10987085
CAPN3	CANP3 \| CANPL3 \| LGMD2 \| LGMD2A \| MGC10767 \| MGC11121 \| MGC14344 \| MGC4403 \| nCL-1 \| p94	calpain 3, (p94)	-	HPRD,BioGRID	8537379 \|9642272
FHL2	AAG11 \| DRAL \| SLIM3	four and a half LIM domains 2	An unspecified isoform of FHL2 (DRAL) interacts with TTN (titin).	BIND	12432079
FHL2	AAG11 \| DRAL \| SLIM3	four and a half LIM domains 2	-	HPRD,BioGRID	12432079
KY	FLJ33207	kyphoscoliosis peptidase	KY interacts with an unspecified isoform of TTN. This interaction was modeled on a demonstrated interaction between mouse KY and human TTN.	BIND	15385448
MYBPC3	CMH4 \| DKFZp779E1762 \| FHC \| MYBP-C	myosin binding protein C, cardiac	-	HPRD,BioGRID	8631348 \|12202917
MYOM1	MGC134946 \| MGC134947 \| SKELEMIN	myomesin 1, 185kDa	-	HPRD	7588733
MYOM2	TTNAP	myomesin (M-protein) 2, 165kDa	-	HPRD	7505783
MYPN	MYOP	myopalladin	Two-hybrid	BioGRID	14583192
NEB	DKFZp686C1456 \| FLJ11505 \| FLJ36536 \| FLJ39568 \| FLJ39584 \| NEB177D \| NEM2	nebulin	-	HPRD	11851340 \|12482578
OBSCN	DKFZp666E245 \| FLJ14124 \| KIAA1556 \| KIAA1639 \| MGC120409 \| MGC120410 \| MGC120411 \| MGC120412 \| MGC138590 \| UNC89	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	-	HPRD,BioGRID	11448995
PUF60	FIR \| FLJ31379 \| RoBPI \| SIAHBP1	poly-U binding splicing factor 60KDa	Affinity Capture-MS	BioGRID	17353931
SQSTM1	A170 \| OSIL \| PDB3 \| ZIP3 \| p60 \| p62 \| p62B	sequestosome 1	Titin interacts with p62. This interaction was modelled on a demonstrated interaction between human Titin and rat p62.	BIND	15802564
TCAP	CMD1N \| LGMD2G \| T-cap \| TELE \| telethonin	titin-cap (telethonin)	-	HPRD,BioGRID	9645487 \|9804419 \|9817758 \|12446666
TCAP	CMD1N \| LGMD2G \| T-cap \| TELE \| telethonin	titin-cap (telethonin)	Titin interacts with telethonin. This interaction was modelled on a demonstrated interaction between human Titin and telethonin from unspecified species.	BIND	15802564
TRIM63	FLJ32380 \| IRF \| MURF1 \| MURF2 \| RNF28 \| SMRZ	tripartite motif-containing 63	Reconstituted Complex Two-hybrid	BioGRID	11243782
TRIM63	FLJ32380 \| IRF \| MURF1 \| MURF2 \| RNF28 \| SMRZ	tripartite motif-containing 63	-	HPRD	11927605

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM	85	65	All SZGR 2.0 genes in this pathway
KEGG DILATED CARDIOMYOPATHY	92	68	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS DN	68	49	All SZGR 2.0 genes in this pathway
HOOI ST7 TARGETS DN	123	78	All SZGR 2.0 genes in this pathway
AKL HTLV1 INFECTION DN	68	41	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA PROGRESSION RISK	74	44	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B	392	251	All SZGR 2.0 genes in this pathway
KORKOLA YOLK SAC TUMOR	62	33	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH VS LOW DN	32	21	All SZGR 2.0 genes in this pathway
DAIRKEE TERT TARGETS DN	124	79	All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER F	54	32	All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO DN	200	112	All SZGR 2.0 genes in this pathway
SHEPARD BMYB TARGETS	74	41	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN	185	111	All SZGR 2.0 genes in this pathway
CHIARETTI ACUTE LYMPHOBLASTIC LEUKEMIA ZAP70	67	33	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP	390	242	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
KUNINGER IGF1 VS PDGFB TARGETS UP	82	51	All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC UP	202	115	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS UP	170	107	All SZGR 2.0 genes in this pathway
DAIRKEE CANCER PRONE RESPONSE BPA E2	118	65	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 UP	295	149	All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE DN	264	159	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO CSF2RB AND IL4 UP	338	225	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF DN	235	144	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN	245	150	All SZGR 2.0 genes in this pathway
GUTIERREZ CHRONIC LYMPHOCYTIC LEUKEMIA DN	56	39	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE	317	190	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	205	211	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-144	204	211	1A,m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-17-5p/20/93.mr/106/519.d	530	536	1A	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-208	538	544	m8	hsa-miR-208	AUAAGACGAGCAAAAAGCUUGU
miR-24	830	836	1A	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-433-3p	574	580	m8	hsa-miR-433^brain	AUCAUGAUGGGCUCCUCGGUGU
miR-451	224	231	1A,m8	hsa-miR-451^brain	AAACCGUUACCAUUACUGAGUUU
miR-493-5p	198	204	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-542-3p	560	566	1A	hsa-miR-542-3p	UGUGACAGAUUGAUAACUGAAA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TTN