SZGR2

Summary ?

GeneID	7447
Symbol	VSNL1
Synonyms	HLP3\|HPCAL3\|HUVISL1\|VILIP\|VILIP-1
Description	visinin like 1
Reference	MIM:600817\|HGNC:HGNC:12722\|Ensembl:ENSG00000163032\|HPRD:02890\|Vega:OTTHUMG00000090645
Gene type	protein-coding
Map location	2p24.3
Pascal p-value	0.028
Sherlock p-value	0.204
Fetal beta	-3.158
eGene	Nucleus accumbens basal ganglia
Support	INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005509	calcium ion binding	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
WEST ADRENOCORTICAL TUMOR MARKERS DN	20	14	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP	285	181	All SZGR 2.0 genes in this pathway
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN	169	118	All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP	423	283	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN	258	141	All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS DN	139	76	All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA UP	141	75	All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS UP	194	112	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN DN	172	112	All SZGR 2.0 genes in this pathway
ODONNELL METASTASIS DN	24	13	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
DAIRKEE TERT TARGETS UP	380	213	All SZGR 2.0 genes in this pathway
BENPORATH ES 1	379	235	All SZGR 2.0 genes in this pathway
LEE TARGETS OF PTCH1 AND SUFU DN	83	69	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS DN	87	69	All SZGR 2.0 genes in this pathway
CROMER METASTASIS DN	81	58	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
JIANG AGING HYPOTHALAMUS DN	40	31	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP	244	165	All SZGR 2.0 genes in this pathway
MCCLUNG DELTA FOSB TARGETS 2WK	48	36	All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS DN	135	88	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD UP	222	139	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP	487	303	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C7	68	44	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BRAIN UP	39	20	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G6 UP	65	43	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS WITH HCP H3K27ME3	102	76	All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP	682	440	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
AZARE NEOPLASTIC TRANSFORMATION BY STAT3 UP	121	70	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF	222	159	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	555	561	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-103/107	294	300	1A	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	294	300	1A	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-124.1	543	550	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	543	549	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	543	549	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-148/152	369	375	1A	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-196	120	127	1A,m8	hsa-miR-196a	UAGGUAGUUUCAUGUUGUUGG
miR-196	120	127	1A,m8	hsa-miR-196b	UAGGUAGUUUCCUGUUGUUGG
miR-217	601	608	1A,m8	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-22	53	59	1A	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-23	231	237	m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	231	237	m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-323	231	237	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-369-3p	495	501	m8	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-381	492	498	m8	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-488	576	582	1A	hsa-miR-488	CCCAGAUAAUGGCACUCUCAA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: VSNL1