Gene Page: VSNL1
Summary ?
GeneID | 7447 |
Symbol | VSNL1 |
Synonyms | HLP3|HPCAL3|HUVISL1|VILIP|VILIP-1 |
Description | visinin like 1 |
Reference | MIM:600817|HGNC:HGNC:12722|Ensembl:ENSG00000163032|HPRD:02890|Vega:OTTHUMG00000090645 |
Gene type | protein-coding |
Map location | 2p24.3 |
Pascal p-value | 0.028 |
Sherlock p-value | 0.204 |
Fetal beta | -3.158 |
eGene | Nucleus accumbens basal ganglia |
Support | INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005509 | calcium ion binding | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
WEST ADRENOCORTICAL TUMOR MARKERS DN | 20 | 14 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP | 285 | 181 | All SZGR 2.0 genes in this pathway |
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN | 169 | 118 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
JAEGER METASTASIS DN | 258 | 141 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS DN | 139 | 76 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA UP | 141 | 75 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS UP | 194 | 112 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN DN | 172 | 112 | All SZGR 2.0 genes in this pathway |
ODONNELL METASTASIS DN | 24 | 13 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
DAIRKEE TERT TARGETS UP | 380 | 213 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
LEE TARGETS OF PTCH1 AND SUFU DN | 83 | 69 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
SMITH TERT TARGETS DN | 87 | 69 | All SZGR 2.0 genes in this pathway |
CROMER METASTASIS DN | 81 | 58 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
JIANG AGING HYPOTHALAMUS DN | 40 | 31 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
MCCLUNG DELTA FOSB TARGETS 2WK | 48 | 36 | All SZGR 2.0 genes in this pathway |
TSENG IRS1 TARGETS DN | 135 | 88 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY NO BLOOD UP | 222 | 139 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C7 | 68 | 44 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BRAIN UP | 39 | 20 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G6 UP | 65 | 43 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS WITH HCP H3K27ME3 | 102 | 76 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
AZARE NEOPLASTIC TRANSFORMATION BY STAT3 UP | 121 | 70 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF | 222 | 159 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 555 | 561 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-103/107 | 294 | 300 | 1A | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-124.1 | 543 | 550 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 543 | 549 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-148/152 | 369 | 375 | 1A | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-196 | 120 | 127 | 1A,m8 | hsa-miR-196a | UAGGUAGUUUCAUGUUGUUGG |
hsa-miR-196b | UAGGUAGUUUCCUGUUGUUGG | ||||
miR-217 | 601 | 608 | 1A,m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
miR-22 | 53 | 59 | 1A | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
miR-23 | 231 | 237 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 231 | 237 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-369-3p | 495 | 501 | m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-381 | 492 | 498 | m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-488 | 576 | 582 | 1A | hsa-miR-488 | CCCAGAUAAUGGCACUCUCAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.