Gene Page: YWHAB
Summary ?
GeneID | 7529 |
Symbol | YWHAB |
Synonyms | GW128|HEL-S-1|HS1|KCIP-1|YWHAA |
Description | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta |
Reference | MIM:601289|HGNC:HGNC:12849|Ensembl:ENSG00000166913|HPRD:03184|Vega:OTTHUMG00000032549 |
Gene type | protein-coding |
Map location | 20q13.1 |
Pascal p-value | 0.011 |
Sherlock p-value | 0.807 |
Fetal beta | -0.55 |
DMG | 1 (# studies) |
eGene | Caudate basal ganglia Cerebellum Cortex Hypothalamus Nucleus accumbens basal ganglia Putamen basal ganglia |
Support | INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_mGluR5 G2Cdb.human_Synaptosome G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0065 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg15324310 | 20 | 43514360 | YWHAB | 1.23E-5 | -0.455 | 0.014 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs3838037 | 20 | 43525483 | YWHAB | ENSG00000166913.8 | 1.14082E-8 | 0 | 11166 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FRS2 | 0.93 | 0.95 |
ZNF451 | 0.93 | 0.94 |
SOCS4 | 0.92 | 0.93 |
MIB1 | 0.92 | 0.93 |
KLHL24 | 0.92 | 0.93 |
GABPA | 0.92 | 0.92 |
KLHL28 | 0.92 | 0.93 |
CEP97 | 0.91 | 0.94 |
ZNF148 | 0.91 | 0.90 |
CREB1 | 0.90 | 0.91 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
IFI27 | -0.61 | -0.70 |
MT-CO2 | -0.61 | -0.69 |
FXYD1 | -0.61 | -0.70 |
AF347015.21 | -0.59 | -0.69 |
CXCL14 | -0.59 | -0.69 |
AF347015.31 | -0.59 | -0.67 |
HIGD1B | -0.58 | -0.67 |
AF347015.8 | -0.57 | -0.66 |
CSAG1 | -0.57 | -0.63 |
AC018755.7 | -0.57 | -0.61 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004497 | monooxygenase activity | IEA | - | |
GO:0019904 | protein domain specific binding | IEA | - | |
GO:0019904 | protein domain specific binding | IPI | 11984006 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007265 | Ras protein signal transduction | EXP | 11520933 | |
GO:0008633 | activation of pro-apoptotic gene products | EXP | 15231831 | |
GO:0006605 | protein targeting | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005813 | centrosome | IDA | 18029348 | |
GO:0005829 | cytosol | EXP | 9069260 |10195903 |12657644 | |
GO:0005634 | nucleus | IDA | 18029348 | |
GO:0005737 | cytoplasm | IDA | 12963375 | |
GO:0048471 | perinuclear region of cytoplasm | IDA | 12963375 | |
GO:0042470 | melanosome | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AKAP13 | AKAP-Lbc | BRX | FLJ11952 | FLJ43341 | HA-3 | Ht31 | LBC | PROTO-LB | PROTO-LBC | c-lbc | A kinase (PRKA) anchor protein 13 | Affinity Capture-MS | BioGRID | 17353931 |
BAD | BBC2 | BCL2L8 | BCL2-associated agonist of cell death | - | HPRD,BioGRID | 9369453 |
BID | FP497 | MGC15319 | MGC42355 | BH3 interacting domain death agonist | - | HPRD | 12871587 |
BRAF | B-RAF1 | BRAF1 | FLJ95109 | MGC126806 | MGC138284 | RAFB1 | v-raf murine sarcoma viral oncogene homolog B1 | BRAF (B-Raf) interacts with an unspecified isoform of YWHAB (14-3-3-beta). | BIND | 12620389 |
BRAF | B-RAF1 | BRAF1 | FLJ95109 | MGC126806 | MGC138284 | RAFB1 | v-raf murine sarcoma viral oncogene homolog B1 | B-RAF interacts with 14-3-3-beta. | BIND | 12620389 |
BRAF | B-RAF1 | BRAF1 | FLJ95109 | MGC126806 | MGC138284 | RAFB1 | v-raf murine sarcoma viral oncogene homolog B1 | - | HPRD,BioGRID | 10931830 |
CBL | C-CBL | CBL2 | RNF55 | Cas-Br-M (murine) ecotropic retroviral transforming sequence | c-Cbl interacts with 14-3-3-beta. | BIND | 9367879 |
CBL | C-CBL | CBL2 | RNF55 | Cas-Br-M (murine) ecotropic retroviral transforming sequence | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 9367879 |
CDC25A | CDC25A2 | cell division cycle 25 homolog A (S. pombe) | - | HPRD,BioGRID | 7644510 |
CDC25A | CDC25A2 | cell division cycle 25 homolog A (S. pombe) | 14-3-3-beta interacts with cdc25A. | BIND | 7644510 |
CDC25B | - | cell division cycle 25 homolog B (S. pombe) | 14-3-3-beta interacts with cdc25B. | BIND | 7644510 |
CDC25B | - | cell division cycle 25 homolog B (S. pombe) | - | HPRD,BioGRID | 7644510 |10713667 |
CDC25C | CDC25 | cell division cycle 25 homolog C (S. pombe) | - | HPRD | 12937170 |
CDC2L1 | CDC2L2 | CDK11 | CDK11-p110 | CDK11-p46 | CDK11-p58 | CLK-1 | FLJ59152 | PK58 | p58 | p58CDC2L1 | p58CLK-1 | cell division cycle 2-like 1 (PITSLRE proteins) | CDK11-p110 interacts with 14-3-3-beta. | BIND | 15883043 |
CGN | DKFZp779N1112 | FLJ39281 | KIAA1319 | cingulin | Affinity Capture-MS | BioGRID | 17353931 |
CRTC2 | RP11-422P24.6 | TORC2 | CREB regulated transcription coactivator 2 | TORC2 interacts with 14-3-3-beta. | BIND | 15454081 |
CSNK2A1 | CK2A1 | CKII | casein kinase 2, alpha 1 polypeptide | Affinity Capture-MS | BioGRID | 17353931 |
DAPK1 | DAPK | DKFZp781I035 | death-associated protein kinase 1 | - | HPRD | 12911633 |
DENND4A | FLJ33949 | IRLB | KIAA0476 | MYCPBP | DENN/MADD domain containing 4A | Affinity Capture-MS | BioGRID | 17353931 |
EDC3 | FLJ21128 | FLJ31777 | LSM16 | YJDC | YJEFN2 | enhancer of mRNA decapping 3 homolog (S. cerevisiae) | Affinity Capture-MS | BioGRID | 17353931 |
EPB41L3 | 4.1B | DAL-1 | DAL1 | FLJ37633 | KIAA0987 | erythrocyte membrane protein band 4.1-like 3 | - | HPRD,BioGRID | 11996670 |
FAM82A2 | FAM82C | FLJ10579 | RMD3 | hRMD-3 | ptpip51 | family with sequence similarity 82, member A2 | Affinity Capture-MS | BioGRID | 17353931 |
FOXK1 | FLJ14977 | FOXK1L | forkhead box K1 | Affinity Capture-MS | BioGRID | 17353931 |
FRYL | DKFZp686E205 | FLJ16177 | KIAA0826 | FRY-like | Affinity Capture-MS | BioGRID | 17353931 |
HDAC4 | HA6116 | HD4 | HDAC-A | HDACA | KIAA0288 | histone deacetylase 4 | Affinity Capture-Western | BioGRID | 10869435 |
HDAC5 | FLJ90614 | HD5 | NY-CO-9 | histone deacetylase 5 | - | HPRD,BioGRID | 10869435 |
IGF1R | CD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216 | insulin-like growth factor 1 receptor | - | HPRD,BioGRID | 9581554 |
IGF1R | CD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216 | insulin-like growth factor 1 receptor | IGFIR interacts with 14-3-3-beta isoform. This interaction was modelled on a demonstrated interaction between human IGFIR and mouse 14-3-3-beta. | BIND | 9581554 |
IRS1 | HIRS-1 | insulin receptor substrate 1 | - | HPRD,BioGRID | 9422753 |
IRS2 | - | insulin receptor substrate 2 | Affinity Capture-MS | BioGRID | 17353931 |
ITGB1 | CD29 | FNRB | GPIIA | MDF2 | MSK12 | VLA-BETA | VLAB | integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) | - | HPRD,BioGRID | 11313964 |
KCNK3 | K2p3.1 | OAT1 | TASK | TASK-1 | TBAK1 | potassium channel, subfamily K, member 3 | Affinity Capture-Western Protein-peptide | BioGRID | 12437930 |
KIF1C | KIAA0706 | LTXS1 | kinesin family member 1C | - | HPRD | 10559254 |
KIF23 | CHO1 | KNSL5 | MKLP-1 | MKLP1 | kinesin family member 23 | Affinity Capture-MS | BioGRID | 17353931 |
KIF5B | KINH | KNS | KNS1 | UKHC | kinesin family member 5B | Affinity Capture-MS | BioGRID | 17353931 |
KLC1 | KLC | KNS2 | KNS2A | MGC15245 | kinesin light chain 1 | Affinity Capture-MS | BioGRID | 17353931 |
KRT18 | CYK18 | K18 | keratin 18 | - | HPRD | 9524113 |
LARP1 | KIAA0731 | LARP | MGC19556 | La ribonucleoprotein domain family, member 1 | Affinity Capture-MS | BioGRID | 17353931 |
LYST | CHS | CHS1 | lysosomal trafficking regulator | - | HPRD,BioGRID | 11984006 |
MAPK7 | BMK1 | ERK4 | ERK5 | PRKM7 | mitogen-activated protein kinase 7 | - | HPRD,BioGRID | 14679215 |
MAPT | DDPAC | FLJ31424 | FTDP-17 | MAPTL | MGC138549 | MSTD | MTBT1 | MTBT2 | PPND | TAU | microtubule-associated protein tau | - | HPRD,BioGRID | 10840038 |
MARK3 | CTAK1 | KP78 | PAR1A | MAP/microtubule affinity-regulating kinase 3 | Affinity Capture-MS | BioGRID | 17353931 |
MLLT4 | AF-6 | AF6 | AFADIN | FLJ34371 | RP3-431P23.3 | myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 | Affinity Capture-MS | BioGRID | 17353931 |
MLXIP | KIAA0867 | MIR | MONDOA | bHLHe36 | MLX interacting protein | - | HPRD,BioGRID | 12446771 |
MPRIP | KIAA0864 | M-RIP | RHOIP3 | p116Rip | myosin phosphatase Rho interacting protein | Affinity Capture-MS | BioGRID | 17353931 |
NCKAP1 | FLJ11291 | HEM2 | KIAA0587 | MGC8981 | NAP1 | NAP125 | NCK-associated protein 1 | Affinity Capture-MS | BioGRID | 17353931 |
OSBPL3 | DKFZp667P1518 | KIAA0704 | MGC21526 | ORP-3 | ORP3 | OSBP3 | oxysterol binding protein-like 3 | Affinity Capture-MS | BioGRID | 17353931 |
PARD3 | ASIP | Baz | Bazooka | FLJ21015 | PAR3 | PAR3alpha | PARD3A | SE2-5L16 | SE2-5LT1 | SE2-5T2 | par-3 partitioning defective 3 homolog (C. elegans) | Affinity Capture-MS | BioGRID | 17353931 |
PDCL2 | GCPHLP | phosducin-like 2 | - | HPRD | 12424248 |
PDE3B | HcGIP1 | cGIPDE1 | phosphodiesterase 3B, cGMP-inhibited | - | HPRD | 12453887 |
PI4KB | PI4K-BETA | PI4KIIIbeta | PI4Kbeta | PIK4CB | pi4K92 | phosphatidylinositol 4-kinase, catalytic, beta | - | HPRD | 15324660 |
PI4KB | PI4K-BETA | PI4KIIIbeta | PI4Kbeta | PIK4CB | pi4K92 | phosphatidylinositol 4-kinase, catalytic, beta | Affinity Capture-MS | BioGRID | 17353931 |
PRKCZ | PKC-ZETA | PKC2 | protein kinase C, zeta | - | HPRD,BioGRID | 10620507 |
PRPF6 | ANT-1 | C20orf14 | TOM | U5-102K | hPrp6 | PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) | Two-hybrid | BioGRID | 10848612 |
PTPN3 | DKFZp686N0569 | PTPH1 | protein tyrosine phosphatase, non-receptor type 3 | - | HPRD,BioGRID | 9341175 |
RABGEF1 | FLJ32302 | RABEX5 | rabex-5 | RAB guanine nucleotide exchange factor (GEF) 1 | Affinity Capture-MS | BioGRID | 17353931 |
RACGAP1 | HsCYK-4 | ID-GAP | MgcRacGAP | Rac GTPase activating protein 1 | Affinity Capture-MS | BioGRID | 17353931 |
RAF1 | CRAF | NS5 | Raf-1 | c-Raf | v-raf-1 murine leukemia viral oncogene homolog 1 | C-RAF interacts with 14-3-3-beta. | BIND | 12620389 |
RAF1 | CRAF | NS5 | Raf-1 | c-Raf | v-raf-1 murine leukemia viral oncogene homolog 1 | - | HPRD | 8702721 |12360521 |
RAF1 | CRAF | NS5 | Raf-1 | c-Raf | v-raf-1 murine leukemia viral oncogene homolog 1 | RAF1 (C-Raf) interacts with YWHAB (14-3-3-beta). | BIND | 12620389 |
RAF1 | CRAF | NS5 | Raf-1 | c-Raf | v-raf-1 murine leukemia viral oncogene homolog 1 | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 8702721 |10620507 |10848612 |12360521 |12620389 |
RAI14 | DKFZp564G013 | KIAA1334 | NORPEG | RAI13 | retinoic acid induced 14 | Affinity Capture-MS | BioGRID | 17353931 |
RASGRF1 | CDC25 | CDC25L | GNRP | GRF1 | GRF55 | H-GRF55 | PP13187 | Ras protein-specific guanine nucleotide-releasing factor 1 | Reconstituted Complex | BioGRID | 9543386 |
RGS3 | C2PA | FLJ20370 | FLJ31516 | FLJ90496 | PDZ-RGS3 | RGP3 | regulator of G-protein signaling 3 | Affinity Capture-Western | BioGRID | 10862767 |
RIN1 | - | Ras and Rab interactor 1 | - | HPRD | 9144171 |11784866 |
RPS6KA1 | HU-1 | MAPKAPK1A | RSK | RSK1 | ribosomal protein S6 kinase, 90kDa, polypeptide 1 | - | HPRD,BioGRID | 12618428 |
SAMD4B | FLJ10211 | MGC99832 | SMGB | sterile alpha motif domain containing 4B | Affinity Capture-MS | BioGRID | 17353931 |
SLC4A7 | DKFZp686H168 | NBC2 | NBC3 | SBC2 | SLC4A6 | solute carrier family 4, sodium bicarbonate cotransporter, member 7 | Affinity Capture-MS | BioGRID | 17353931 |
SNCA | MGC110988 | NACP | PARK1 | PARK4 | PD1 | synuclein, alpha (non A4 component of amyloid precursor) | - | HPRD | 10407019 |
SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | - | HPRD | 8702721 |
SRRM2 | 300-KD | CWF21 | DKFZp686O15166 | FLJ21926 | FLJ22250 | KIAA0324 | MGC40295 | SRL300 | SRm300 | serine/arginine repetitive matrix 2 | Affinity Capture-MS | BioGRID | 17353931 |
TESK1 | - | testis-specific kinase 1 | - | HPRD,BioGRID | 11555644 |
TESK2 | - | testis-specific kinase 2 | - | HPRD,BioGRID | 11555644 |
TJP2 | MGC26306 | X104 | ZO-2 | ZO2 | tight junction protein 2 (zona occludens 2) | Affinity Capture-MS | BioGRID | 17353931 |
TNFAIP3 | A20 | MGC104522 | MGC138687 | MGC138688 | OTUD7C | TNFA1P2 | tumor necrosis factor, alpha-induced protein 3 | - | HPRD,BioGRID | 8702721 |
TSC1 | KIAA0243 | LAM | MGC86987 | TSC | tuberous sclerosis 1 | Hamartin interacts with 14-3-3-beta. This interaction is modeled on demonstrated interaction between human hamartin and mouse 14-3-3-beta isoform. | BIND | 12176984 |
TSC2 | FLJ43106 | LAM | TSC4 | tuberous sclerosis 2 | - | HPRD | 12438239 |12468542 |
TSC2 | FLJ43106 | LAM | TSC4 | tuberous sclerosis 2 | The tumor suppressor protein tuberin interacts with 14-3-3-beta isoform. This interaction is modeled on demonstrated interaction between human tuberin and mouse 14-3-3-beta isoform. | BIND | 12176984 |
UCP2 | BMIQ4 | SLC25A8 | UCPH | uncoupling protein 2 (mitochondrial, proton carrier) | - | HPRD,BioGRID | 10785390 |
UCP2 | BMIQ4 | SLC25A8 | UCPH | uncoupling protein 2 (mitochondrial, proton carrier) | UCP2 interacts with 14.3.3-beta. | BIND | 10785390 |
UCP3 | SLC25A9 | uncoupling protein 3 (mitochondrial, proton carrier) | UCP3 interacts with 14.3.3-beta. | BIND | 10785390 |
UCP3 | SLC25A9 | uncoupling protein 3 (mitochondrial, proton carrier) | - | HPRD,BioGRID | 10785390 |
USP8 | FLJ34456 | HumORF8 | KIAA0055 | MGC129718 | UBPY | ubiquitin specific peptidase 8 | Affinity Capture-MS | BioGRID | 17353931 |
WEE1 | DKFZp686I18166 | FLJ16446 | WEE1A | WEE1hu | WEE1 homolog (S. pombe) | - | HPRD,BioGRID | 10775038 |
YWHAB | GW128 | HS1 | KCIP-1 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide | - | HPRD | 12453887 |
ZFP36 | G0S24 | GOS24 | NUP475 | RNF162A | TIS11 | TTP | zinc finger protein 36, C3H type, homolog (mouse) | - | HPRD,BioGRID | 11886850 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CELL CYCLE | 128 | 84 | All SZGR 2.0 genes in this pathway |
KEGG OOCYTE MEIOSIS | 114 | 79 | All SZGR 2.0 genes in this pathway |
KEGG NEUROTROPHIN SIGNALING PATHWAY | 126 | 103 | All SZGR 2.0 genes in this pathway |
BIOCARTA CHREBP2 PATHWAY | 42 | 35 | All SZGR 2.0 genes in this pathway |
SIG PIP3 SIGNALING IN CARDIAC MYOCTES | 67 | 54 | All SZGR 2.0 genes in this pathway |
SIG INSULIN RECEPTOR PATHWAY IN CARDIAC MYOCYTES | 51 | 41 | All SZGR 2.0 genes in this pathway |
ST PHOSPHOINOSITIDE 3 KINASE PATHWAY | 37 | 29 | All SZGR 2.0 genes in this pathway |
PID HDAC CLASSII PATHWAY | 34 | 27 | All SZGR 2.0 genes in this pathway |
PID ATR PATHWAY | 39 | 25 | All SZGR 2.0 genes in this pathway |
PID ATM PATHWAY | 34 | 25 | All SZGR 2.0 genes in this pathway |
PID LKB1 PATHWAY | 47 | 37 | All SZGR 2.0 genes in this pathway |
PID NFAT 3PATHWAY | 54 | 47 | All SZGR 2.0 genes in this pathway |
PID MTOR 4PATHWAY | 69 | 55 | All SZGR 2.0 genes in this pathway |
PID FOXO PATHWAY | 49 | 43 | All SZGR 2.0 genes in this pathway |
PID ERBB1 DOWNSTREAM PATHWAY | 105 | 78 | All SZGR 2.0 genes in this pathway |
PID PDGFRB PATHWAY | 129 | 103 | All SZGR 2.0 genes in this pathway |
PID P38 MK2 PATHWAY | 21 | 19 | All SZGR 2.0 genes in this pathway |
PID BETA CATENIN NUC PATHWAY | 80 | 60 | All SZGR 2.0 genes in this pathway |
PID A6B1 A6B4 INTEGRIN PATHWAY | 46 | 35 | All SZGR 2.0 genes in this pathway |
PID INSULIN GLUCOSE PATHWAY | 26 | 24 | All SZGR 2.0 genes in this pathway |
PID PI3KCI AKT PATHWAY | 35 | 30 | All SZGR 2.0 genes in this pathway |
PID PI3K PLC TRK PATHWAY | 36 | 31 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY SCF KIT | 78 | 59 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ERBB4 | 90 | 67 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ERBB2 | 101 | 78 | All SZGR 2.0 genes in this pathway |
REACTOME GRB2 EVENTS IN ERBB2 SIGNALING | 22 | 20 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY EGFR IN CANCER | 109 | 80 | All SZGR 2.0 genes in this pathway |
REACTOME SHC1 EVENTS IN ERBB4 SIGNALING | 20 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY HIPPO | 22 | 15 | All SZGR 2.0 genes in this pathway |
REACTOME INSULIN RECEPTOR SIGNALLING CASCADE | 87 | 64 | All SZGR 2.0 genes in this pathway |
REACTOME ARMS MEDIATED ACTIVATION | 17 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME PROLONGED ERK ACTIVATION EVENTS | 19 | 18 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING TO RAS | 27 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE | 137 | 105 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING TO ERKS | 36 | 30 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY FGFR IN DISEASE | 127 | 88 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING TO P38 VIA RIT AND RIN | 15 | 14 | All SZGR 2.0 genes in this pathway |
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK | 205 | 136 | All SZGR 2.0 genes in this pathway |
REACTOME SHC1 EVENTS IN EGFR SIGNALING | 15 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY PDGF | 122 | 93 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNAL TRANSDUCTION | 95 | 76 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME NCAM SIGNALING FOR NEURITE OUT GROWTH | 64 | 49 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF MRNA | 284 | 128 | All SZGR 2.0 genes in this pathway |
REACTOME FRS2 MEDIATED CASCADE | 36 | 27 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF RNA | 330 | 155 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNALING OF ACTIVATED FGFR | 100 | 74 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ILS | 107 | 86 | All SZGR 2.0 genes in this pathway |
REACTOME RAP1 SIGNALLING | 17 | 12 | All SZGR 2.0 genes in this pathway |
REACTOME DESTABILIZATION OF MRNA BY BRF1 | 17 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF MRNA STABILITY BY PROTEINS THAT BIND AU RICH ELEMENTS | 84 | 50 | All SZGR 2.0 genes in this pathway |
REACTOME DESTABILIZATION OF MRNA BY TRISTETRAPROLIN TTP | 17 | 7 | All SZGR 2.0 genes in this pathway |
REACTOME IL 2 SIGNALING | 41 | 34 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY INSULIN RECEPTOR | 108 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME SOS MEDIATED SIGNALLING | 14 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME APOPTOSIS | 148 | 94 | All SZGR 2.0 genes in this pathway |
REACTOME RAF MAP KINASE CASCADE | 10 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME SHC MEDIATED SIGNALLING | 15 | 12 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATION OF BH3 ONLY PROTEINS | 17 | 12 | All SZGR 2.0 genes in this pathway |
REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY FGFR | 112 | 80 | All SZGR 2.0 genes in this pathway |
REACTOME INTRINSIC PATHWAY FOR APOPTOSIS | 30 | 21 | All SZGR 2.0 genes in this pathway |
REACTOME SHC RELATED EVENTS | 17 | 13 | All SZGR 2.0 genes in this pathway |
WIKMAN ASBESTOS LUNG CANCER UP | 17 | 11 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION UP | 119 | 66 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
CREIGHTON AKT1 SIGNALING VIA MTOR DN | 23 | 16 | All SZGR 2.0 genes in this pathway |
DARWICHE SKIN TUMOR PROMOTER UP | 142 | 96 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK LOW UP | 162 | 104 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK HIGH DN | 180 | 110 | All SZGR 2.0 genes in this pathway |
DARWICHE SQUAMOUS CELL CARCINOMA UP | 146 | 104 | All SZGR 2.0 genes in this pathway |
SCHEIDEREIT IKK TARGETS | 18 | 15 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
BERTUCCI INVASIVE CARCINOMA DUCTAL VS LOBULAR UP | 25 | 17 | All SZGR 2.0 genes in this pathway |
DEN INTERACT WITH LCA5 | 26 | 21 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 20Q12 Q13 AMPLICON | 149 | 76 | All SZGR 2.0 genes in this pathway |
FAELT B CLL WITH VH3 21 DN | 49 | 29 | All SZGR 2.0 genes in this pathway |
LEE AGING NEOCORTEX DN | 80 | 49 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
RAMALHO STEMNESS UP | 206 | 118 | All SZGR 2.0 genes in this pathway |
PAL PRMT5 TARGETS UP | 203 | 135 | All SZGR 2.0 genes in this pathway |
ZHONG SECRETOME OF LUNG CANCER AND FIBROBLAST | 132 | 93 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
BEIER GLIOMA STEM CELL DN | 66 | 42 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER SURVIVAL DN | 175 | 103 | All SZGR 2.0 genes in this pathway |
CHAUHAN RESPONSE TO METHOXYESTRADIOL DN | 102 | 65 | All SZGR 2.0 genes in this pathway |
HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 273 | 280 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-148/152 | 1667 | 1674 | 1A,m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-200bc/429 | 1841 | 1847 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-214 | 1640 | 1646 | 1A | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
miR-218 | 1888 | 1894 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-27 | 274 | 280 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-361 | 363 | 369 | m8 | hsa-miR-361brain | UUAUCAGAAUCUCCAGGGGUAC |
miR-488 | 1804 | 1810 | m8 | hsa-miR-488 | CCCAGAUAAUGGCACUCUCAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.