SZGR2

Summary ?

GeneID	754
Symbol	PTTG1IP
Synonyms	C21orf1\|C21orf3\|PBF
Description	pituitary tumor-transforming 1 interacting protein
Reference	MIM:603784\|HGNC:HGNC:13524\|Ensembl:ENSG00000183255\|HPRD:04807\|Vega:OTTHUMG00000090254
Gene type	protein-coding
Map location	21q22.3
Pascal p-value	0.763
Sherlock p-value	0.367
DMG	3 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	3
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	3
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	3
Expression	Meta-analysis of gene expression	P value: 1.44

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg12121965	21	46293563	PTTG1IP	6.58E-5	-0.216	0.024	DMG:Wockner_2014
cg02114786	21	46293672	PTTG1IP		-0.026	0.31	DMG:Nishioka_2013
cg02114786	21	46293672	PTTG1IP	4.24E-11	-0.011	3.83E-7	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs7740200	chr6	16048563	PTTG1IP	754		0.16		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SATB2	0.92	0.95
TSPAN14	0.91	0.86
SLA	0.91	0.87
TMEM108	0.90	0.85
TLE3	0.90	0.86
ATXN7L1	0.90	0.85
ADRA2A	0.89	0.92
TBC1D30	0.89	0.88
GPRIN1	0.89	0.89
SOBP	0.89	0.89

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SERPINB6	-0.68	-0.76
HEPN1	-0.67	-0.75
BDH2	-0.66	-0.80
HSD17B14	-0.66	-0.78
AIFM3	-0.65	-0.75
TSC22D4	-0.65	-0.76
HLA-F	-0.64	-0.70
S100B	-0.64	-0.80
CLU	-0.64	-0.68
AP003117.1	-0.63	-0.65

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003674	molecular_function	ND		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006606	protein import into nucleus	IDA		10781616
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IDA		10781616
GO:0005737	cytoplasm	IDA		10781616
GO:0016020	membrane	NAS		-
GO:0016021	integral to membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
UDAYAKUMAR MED1 TARGETS DN	240	171	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
LEI MYB TARGETS	318	215	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 2	72	52	All SZGR 2.0 genes in this pathway
BACOLOD RESISTANCE TO ALKYLATING AGENTS DN	60	45	All SZGR 2.0 genes in this pathway
MARCHINI TRABECTEDIN RESISTANCE DN	49	34	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS UP	317	208	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP	973	570	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP	863	514	All SZGR 2.0 genes in this pathway
BASSO HAIRY CELL LEUKEMIA DN	80	66	All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN	238	145	All SZGR 2.0 genes in this pathway
ELLWOOD MYC TARGETS DN	40	27	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP	442	263	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP	259	159	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D	882	506	All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF	367	231	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	1939	1946	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	1938	1945	1A,m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	1938	1945	1A,m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PTTG1IP