Gene Page: EHMT1
Summary ?
| GeneID | 79813 |
| Symbol | EHMT1 |
| Synonyms | EUHMTASE1|Eu-HMTase1|FP13812|GLP|GLP1|KMT1D|bA188C12.1 |
| Description | euchromatic histone-lysine N-methyltransferase 1 |
| Reference | MIM:607001|HGNC:HGNC:24650|Ensembl:ENSG00000181090|HPRD:07383|Vega:OTTHUMG00000020995 |
| Gene type | protein-coding |
| Map location | 9q34.3 |
| Pascal p-value | 0.438 |
| Fetal beta | 1.309 |
| Support | CompositeSet Darnell FMRP targets Ascano FMRP targets Chromatin Remodeling Genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Expression | Meta-analysis of gene expression | P value: 1.836 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016740 | transferase activity | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0008168 | methyltransferase activity | IDA | 12004135 | |
| GO:0018024 | histone-lysine N-methyltransferase activity | IDA | 12004135 | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016568 | chromatin modification | IDA | 12004135 | |
| GO:0016571 | histone methylation | IDA | 12004135 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IC | 12004135 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG LYSINE DEGRADATION | 44 | 29 | All SZGR 2.0 genes in this pathway |
| WANG LMO4 TARGETS DN | 352 | 225 | All SZGR 2.0 genes in this pathway |
| BILD SRC ONCOGENIC SIGNATURE | 62 | 38 | All SZGR 2.0 genes in this pathway |
| MATZUK EMBRYONIC GERM CELL | 19 | 16 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-18 | 679 | 685 | m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
| hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
| miR-217 | 1052 | 1058 | m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
| miR-375 | 851 | 857 | 1A | hsa-miR-375 | UUUGUUCGUUCGGCUCGCGUGA |
| miR-409-3p | 1042 | 1049 | 1A,m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.