Gene Page: FZD9
Summary ?
| GeneID | 8326 |
| Symbol | FZD9 |
| Synonyms | CD349|FZD3 |
| Description | frizzled class receptor 9 |
| Reference | MIM:601766|HGNC:HGNC:4047|Ensembl:ENSG00000188763|HPRD:03460|Vega:OTTHUMG00000023051 |
| Gene type | protein-coding |
| Map location | 7q11.23 |
| Pascal p-value | 0.166 |
| Sherlock p-value | 0.004 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CNV:YES | Copy number variation studies | Manual curation | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| snp_a-2100866 | 0 | FZD9 | 8326 | 0.18 | trans | |||
| rs7120394 | chr11 | 74034472 | FZD9 | 8326 | 0.14 | trans | ||
| rs479968 | chr11 | 74038273 | FZD9 | 8326 | 0.2 | trans | ||
| rs7139272 | chr12 | 53722127 | FZD9 | 8326 | 0.02 | trans | ||
| rs9570060 | chr13 | 59754134 | FZD9 | 8326 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004872 | receptor activity | IEA | - | |
| GO:0004930 | G-protein coupled receptor activity | IEA | - | |
| GO:0004926 | non-G-protein coupled 7TM receptor activity | IEA | - | |
| GO:0042813 | Wnt receptor activity | TAS | 9147651 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007405 | neuroblast proliferation | IEA | neuron (GO term level: 8) | - |
| GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 9147651 |
| GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | - | |
| GO:0016055 | Wnt receptor signaling pathway | IEA | - | |
| GO:0007611 | learning or memory | IEA | - | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016021 | integral to membrane | TAS | 9147651 | |
| GO:0005886 | plasma membrane | TAS | 9147651 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG WNT SIGNALING PATHWAY | 151 | 112 | All SZGR 2.0 genes in this pathway |
| KEGG MELANOGENESIS | 102 | 80 | All SZGR 2.0 genes in this pathway |
| KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
| KEGG BASAL CELL CARCINOMA | 55 | 44 | All SZGR 2.0 genes in this pathway |
| PID WNT SIGNALING PATHWAY | 28 | 23 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS | 88 | 58 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
| HAMAI APOPTOSIS VIA TRAIL DN | 186 | 107 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM4 | 261 | 153 | All SZGR 2.0 genes in this pathway |
| SHEPARD CRUSH AND BURN MUTANT DN | 185 | 111 | All SZGR 2.0 genes in this pathway |
| HANN RESISTANCE TO BCL2 INHIBITOR DN | 48 | 31 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
| EHLERS ANEUPLOIDY DN | 12 | 8 | All SZGR 2.0 genes in this pathway |
| GRADE COLON VS RECTAL CANCER DN | 56 | 36 | All SZGR 2.0 genes in this pathway |
| VART KSHV INFECTION ANGIOGENIC MARKERS UP | 165 | 118 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER ESR1 DN | 240 | 153 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-145 | 314 | 320 | 1A | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.