Gene Page: CASQ2
Summary ?
GeneID | 845 |
Symbol | CASQ2 |
Synonyms | PDIB2 |
Description | calsequestrin 2 |
Reference | MIM:114251|HGNC:HGNC:1513|Ensembl:ENSG00000118729|HPRD:00256|Vega:OTTHUMG00000011970 |
Gene type | protein-coding |
Map location | 1p13.1 |
Pascal p-value | 0.287 |
Fetal beta | -1.805 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg18942631 | 1 | 116311341 | CASQ2 | 2.342E-4 | -0.351 | 0.037 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005509 | calcium ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007507 | heart development | TAS | 9795116 | |
GO:0006941 | striated muscle contraction | TAS | 9795116 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0033018 | sarcoplasmic reticulum lumen | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER DN | 232 | 154 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
EBAUER MYOGENIC TARGETS OF PAX3 FOXO1 FUSION | 50 | 26 | All SZGR 2.0 genes in this pathway |
RICKMAN HEAD AND NECK CANCER F | 54 | 32 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA UP | 98 | 64 | All SZGR 2.0 genes in this pathway |
XU GH1 EXOGENOUS TARGETS UP | 85 | 50 | All SZGR 2.0 genes in this pathway |
LEIN CEREBELLUM MARKERS | 85 | 47 | All SZGR 2.0 genes in this pathway |
ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
YAUCH HEDGEHOG SIGNALING PARACRINE DN | 264 | 159 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA2 DN | 80 | 51 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 | 227 | 149 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
CHEMELLO SOLEUS VS EDL MYOFIBERS UP | 35 | 16 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 1025 | 1031 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.