SZGR2

Summary ?

GeneID	8499
Symbol	PPFIA2
Synonyms	-
Description	PTPRF interacting protein alpha 2
Reference	MIM:603143\|HGNC:HGNC:9246\|Ensembl:ENSG00000139220\|HPRD:04392\|Vega:OTTHUMG00000170181
Gene type	protein-coding
Map location	12q21.31
Pascal p-value	0.365
Fetal beta	0.168
eGene	Caudate basal ganglia
Support	PROTEIN CLUSTERING G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MAPRE3	0.87	0.88
ATP6V0A1	0.87	0.88
WARS	0.86	0.85
BECN1	0.86	0.84
AARS	0.86	0.88
PDHX	0.86	0.83
DDX24	0.86	0.81
UQCC	0.85	0.85
PCMT1	0.85	0.87
NDEL1	0.85	0.85

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.55	-0.30
AF347015.18	-0.54	-0.30
AP002478.3	-0.51	-0.44
AF347015.2	-0.51	-0.28
RAB34	-0.49	-0.53
AF347015.8	-0.47	-0.26
AF347015.31	-0.47	-0.30
IL32	-0.47	-0.29
MT-CO2	-0.46	-0.28
AC100783.1	-0.46	-0.34

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		12923177
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007160	cell-matrix adhesion	TAS		9624153
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0019717	synaptosome	IEA	Synap, Brain (GO term level: 7)	-
GO:0005737	cytoplasm	TAS		9624153
GO:0009986	cell surface	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ERC2	CAST \| CAST1 \| ELKSL \| KIAA0378 \| MGC133063 \| MGC133064 \| SPBC110 \| Spc110	ELKS/RAB6-interacting/CAST family member 2	-	HPRD,BioGRID	12923177
ERC2	CAST \| CAST1 \| ELKSL \| KIAA0378 \| MGC133063 \| MGC133064 \| SPBC110 \| Spc110	ELKS/RAB6-interacting/CAST family member 2	Liprin-alpha2 interacts with ERC2.	BIND	12923177
GIT1	-	G protein-coupled receptor kinase interacting ArfGAP 1	Reconstituted Complex Two-hybrid	BioGRID	12923177
GIT1	-	G protein-coupled receptor kinase interacting ArfGAP 1	-	HPRD	12629171
GIT1	-	G protein-coupled receptor kinase interacting ArfGAP 1	Liprin-alpha2 interacts with GIT1. This interaction was modeled on a demonstrated interaction between human liprin-alpha2 and rat GIT1.	BIND	12923177
PPFIA1	FLJ41337 \| FLJ42630 \| FLJ43474 \| LIP.1 \| LIP1 \| LIPRIN \| MGC26800	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	-	HPRD,BioGRID	9624153
PPFIA2	FLJ41378 \| MGC132572	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	-	HPRD,BioGRID	9624153
PPFIA3	KIAA0654 \| LPNA3 \| MGC126567 \| MGC126569	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	-	HPRD,BioGRID	9624153
PPFIBP1	L2 \| hSGT2 \| hSgt2p	PTPRF interacting protein, binding protein 1 (liprin beta 1)	-	HPRD,BioGRID	9624153
PPFIBP2	Cclp1 \| DKFZp781K06126 \| MGC42541	PTPRF interacting protein, binding protein 2 (liprin beta 2)	-	HPRD,BioGRID	9624153
PPP2CA	PP2Ac \| PP2CA \| RP-C	protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform	Affinity Capture-MS	BioGRID	18782753
PPP2R1A	MGC786 \| PR65A	protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform	Affinity Capture-MS	BioGRID	18782753
PTPRD	HPTP \| HPTP-DELTA \| HPTPD \| MGC119750 \| MGC119751 \| MGC119752 \| MGC119753 \| PTPD \| R-PTP-DELTA	protein tyrosine phosphatase, receptor type, D	-	HPRD,BioGRID	9624153
PTPRF	FLJ43335 \| FLJ45062 \| FLJ45567 \| LAR	protein tyrosine phosphatase, receptor type, F	-	HPRD,BioGRID	9624153
PTPRS	PTPSIGMA	protein tyrosine phosphatase, receptor type, S	-	HPRD,BioGRID	9624153

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ZHOU INFLAMMATORY RESPONSE LPS UP	431	237	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN	150	99	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA NEURAL	129	85	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-130/301	65	71	1A	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-148/152	21	27	1A	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PPFIA2