SZGR2

Summary ?

GeneID	8675
Symbol	STX16
Synonyms	SYN16
Description	syntaxin 16
Reference	MIM:603666\|HGNC:HGNC:11431\|Ensembl:ENSG00000124222\|HPRD:04718\|Vega:OTTHUMG00000033084
Gene type	protein-coding
Map location	20q13.32
Pascal p-value	7.855E-4
Sherlock p-value	0.513
eGene	Myers' cis & trans
Support	INTRACELLULAR TRAFFICKING

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs762126	chr8	37472686	STX16	8675		0.15		trans
rs713190	chr8	37473069	STX16	8675		0.17		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005484	SNAP receptor activity	IDA		15215310
GO:0005484	SNAP receptor activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006886	intracellular protein transport	IEA		-
GO:0006891	intra-Golgi vesicle-mediated transport	TAS		9464276
GO:0016192	vesicle-mediated transport	IEA		-
GO:0042147	retrograde transport, endosome to Golgi	IDA		15215310
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0031201	SNARE complex	TAS	neuron, Synap (GO term level: 6)	15215310
GO:0000139	Golgi membrane	IEA		-
GO:0005792	microsome	TAS		9587053
GO:0005794	Golgi apparatus	TAS		9587053
GO:0005737	cytoplasm	TAS		9587053
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG SNARE INTERACTIONS IN VESICULAR TRANSPORT	38	25	All SZGR 2.0 genes in this pathway
REACTOME BOTULINUM NEUROTOXICITY	19	14	All SZGR 2.0 genes in this pathway
REACTOME PROTEOLYTIC CLEAVAGE OF SNARE COMPLEX PROTEINS	17	12	All SZGR 2.0 genes in this pathway
REACTOME NEURONAL SYSTEM	279	221	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP	473	314	All SZGR 2.0 genes in this pathway
LAIHO COLORECTAL CANCER SERRATED DN	86	47	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED UP	78	48	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION UP	119	66	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA SIZE UP	23	12	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP	722	443	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP	530	342	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP	239	157	All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER UP	142	96	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW UP	162	104	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH UP	147	101	All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA UP	146	104	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 TTD UP	64	39	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE UP	134	93	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP	309	199	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS	775	494	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 20Q12 Q13 AMPLICON	149	76	All SZGR 2.0 genes in this pathway
SHIPP DLBCL VS FOLLICULAR LYMPHOMA DN	45	28	All SZGR 2.0 genes in this pathway
GALE APL WITH FLT3 MUTATED UP	56	35	All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND DN	225	163	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP	244	165	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE	200	115	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 4 UP	112	64	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP	430	288	All SZGR 2.0 genes in this pathway
AZARE NEOPLASTIC TRANSFORMATION BY STAT3 UP	121	70	All SZGR 2.0 genes in this pathway
LOPEZ TRANSLATION VIA FN1 SIGNALING	35	21	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-122	1017	1023	1A	hsa-miR-122a	UGGAGUGUGACAAUGGUGUUUGU
miR-128	938	944	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	938	944	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-132/212	3157	3163	1A	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
				hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
				hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
				hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-137	3096	3102	m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-137	3096	3102	m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-145	3163	3169	1A	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-193	644	650	m8	hsa-miR-193a	AACUGGCCUACAAAGUCCCAG
miR-193	644	650	m8	hsa-miR-193b	AACUGGCCCUCAAAGUCCCGCUUU
miR-194	3158	3164	m8	hsa-miR-194	UGUAACAGCAACUCCAUGUGGA
miR-200bc/429	3222	3228	1A	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-203.1	1022	1028	1A	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-27	938	945	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	938	945	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-299-5p	729	736	1A,m8	hsa-miR-299-5p	UGGUUUACCGUCCCACAUACAU
miR-377	595	601	1A	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-493-5p	3176	3182	1A	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: STX16