Gene Page: PEA15
Summary ?
| GeneID | 8682 |
| Symbol | PEA15 |
| Synonyms | HMAT1|HUMMAT1H|MAT1|MAT1H|PEA-15|PED |
| Description | phosphoprotein enriched in astrocytes 15 |
| Reference | MIM:603434|HGNC:HGNC:8822|Ensembl:ENSG00000162734|HPRD:04579|Vega:OTTHUMG00000031605 |
| Gene type | protein-coding |
| Map location | 1q21.1 |
| Sherlock p-value | 0.003 |
| Fetal beta | -0.962 |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0161 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MPP5 | 0.87 | 0.90 |
| USP8 | 0.86 | 0.85 |
| CCDC47 | 0.86 | 0.84 |
| TOR1AIP1 | 0.86 | 0.87 |
| STAT3 | 0.84 | 0.85 |
| ACBD5 | 0.84 | 0.84 |
| ERAP1 | 0.83 | 0.86 |
| KIAA0776 | 0.83 | 0.83 |
| SPRED1 | 0.83 | 0.84 |
| SENP2 | 0.83 | 0.78 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RPL35 | -0.41 | -0.48 |
| IL32 | -0.41 | -0.29 |
| AP003068.3 | -0.40 | -0.40 |
| AF347015.21 | -0.39 | -0.14 |
| FAM159B | -0.39 | -0.37 |
| RPL36 | -0.38 | -0.46 |
| RPS21 | -0.38 | -0.45 |
| C1orf61 | -0.38 | -0.27 |
| AL022328.1 | -0.37 | -0.29 |
| APOC1 | -0.37 | -0.12 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005351 | sugar:hydrogen symporter activity | IEA | - | |
| GO:0005515 | protein binding | IPI | 10442631 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008643 | carbohydrate transport | IEA | - | |
| GO:0006916 | anti-apoptosis | IDA | 10442631 | |
| GO:0042981 | regulation of apoptosis | IDA | 10442631 | |
| GO:0046325 | negative regulation of glucose import | IDA | 9670003 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005875 | microtubule associated complex | NAS | 8662970 | |
| GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ABCD4 | ABC41 | EST352188 | P70R | P79R | PMP69 | PXMP1L | ATP-binding cassette, sub-family D (ALD), member 4 | Two-hybrid | BioGRID | 16169070 |
| AKT1 | AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHA | v-akt murine thymoma viral oncogene homolog 1 | Akt interacts with PED. | BIND | 12808093 |
| CASP8 | ALPS2B | CAP4 | FLICE | FLJ17672 | MACH | MCH5 | MGC78473 | caspase 8, apoptosis-related cysteine peptidase | - | HPRD,BioGRID | 10442631 |10493725 |
| FADD | GIG3 | MGC8528 | MORT1 | Fas (TNFRSF6)-associated via death domain | - | HPRD,BioGRID | 10442631 |10493725 |
| L1CAM | CAML1 | CD171 | HSAS | HSAS1 | MASA | MIC5 | N-CAML1 | S10 | SPG1 | L1 cell adhesion molecule | Two-hybrid | BioGRID | 16169070 |
| LUC7L2 | CGI-59 | CGI-74 | FLJ10657 | LUC7B2 | LUC7-like 2 (S. cerevisiae) | Two-hybrid | BioGRID | 16169070 |
| MAPK1 | ERK | ERK2 | ERT1 | MAPK2 | P42MAPK | PRKM1 | PRKM2 | p38 | p40 | p41 | p41mapk | mitogen-activated protein kinase 1 | - | HPRD,BioGRID | 11702783 |
| MAPK3 | ERK1 | HS44KDAP | HUMKER1A | MGC20180 | P44ERK1 | P44MAPK | PRKM3 | mitogen-activated protein kinase 3 | - | HPRD,BioGRID | 11702783 |
| MAPK3 | ERK1 | HS44KDAP | HUMKER1A | MGC20180 | P44ERK1 | P44MAPK | PRKM3 | mitogen-activated protein kinase 3 | PEA-15 interacts with ERK 1. | BIND | 11702783 |
| PLD1 | - | phospholipase D1, phosphatidylcholine-specific | - | HPRD,BioGRID | 10926929 |
| PLD2 | - | phospholipase D2 | - | HPRD,BioGRID | 10926929 |
| RPS6KA3 | CLS | HU-3 | ISPK-1 | MAPKAPK1B | MRX19 | RSK | RSK2 | S6K-alpha3 | p90-RSK2 | pp90RSK2 | ribosomal protein S6 kinase, 90kDa, polypeptide 3 | - | HPRD,BioGRID | 12796492 |
| RPS6KA3 | CLS | HU-3 | ISPK-1 | MAPKAPK1B | MRX19 | RSK | RSK2 | S6K-alpha3 | p90-RSK2 | pp90RSK2 | ribosomal protein S6 kinase, 90kDa, polypeptide 3 | PEA-15 interacts with RSK2. | BIND | 12796492 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PID P73PATHWAY | 79 | 59 | All SZGR 2.0 genes in this pathway |
| NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP | 285 | 181 | All SZGR 2.0 genes in this pathway |
| ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
| CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 UP | 146 | 86 | All SZGR 2.0 genes in this pathway |
| DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
| HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
| DOANE RESPONSE TO ANDROGEN UP | 184 | 125 | All SZGR 2.0 genes in this pathway |
| ROY WOUND BLOOD VESSEL UP | 50 | 30 | All SZGR 2.0 genes in this pathway |
| UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS 8HR UP | 164 | 122 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS 12HR UP | 162 | 116 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
| PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| FRIDMAN SENESCENCE UP | 77 | 60 | All SZGR 2.0 genes in this pathway |
| BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
| MORI MATURE B LYMPHOCYTE UP | 90 | 62 | All SZGR 2.0 genes in this pathway |
| LE EGR2 TARGETS DN | 108 | 84 | All SZGR 2.0 genes in this pathway |
| SANA TNF SIGNALING DN | 90 | 57 | All SZGR 2.0 genes in this pathway |
| SANA RESPONSE TO IFNG DN | 85 | 56 | All SZGR 2.0 genes in this pathway |
| LEE LIVER CANCER DENA UP | 60 | 40 | All SZGR 2.0 genes in this pathway |
| NADLER OBESITY UP | 61 | 34 | All SZGR 2.0 genes in this pathway |
| LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
| GERY CEBP TARGETS | 126 | 90 | All SZGR 2.0 genes in this pathway |
| REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
| CHANG IMMORTALIZED BY HPV31 DN | 65 | 45 | All SZGR 2.0 genes in this pathway |
| JIANG VHL TARGETS | 138 | 91 | All SZGR 2.0 genes in this pathway |
| WANG CISPLATIN RESPONSE AND XPC DN | 228 | 146 | All SZGR 2.0 genes in this pathway |
| SESTO RESPONSE TO UV C1 | 72 | 45 | All SZGR 2.0 genes in this pathway |
| LIU SMARCA4 TARGETS | 64 | 39 | All SZGR 2.0 genes in this pathway |
| JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
| ZAMORA NOS2 TARGETS DN | 96 | 71 | All SZGR 2.0 genes in this pathway |
| DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS DN | 105 | 63 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
| MARZEC IL2 SIGNALING UP | 115 | 80 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
| MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
| RUIZ TNC TARGETS DN | 142 | 79 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
| HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
| CAIRO HEPATOBLASTOMA CLASSES DN | 210 | 141 | All SZGR 2.0 genes in this pathway |
| DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
| LI INDUCED T TO NATURAL KILLER UP | 307 | 182 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 1 UP | 7 | 5 | All SZGR 2.0 genes in this pathway |
| PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
| TERAO AOX4 TARGETS HG UP | 28 | 20 | All SZGR 2.0 genes in this pathway |
| KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| BOUDOUKHA BOUND BY IGF2BP2 | 111 | 59 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 1527 | 1534 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA | ||||
| miR-124/506 | 1527 | 1533 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA | ||||
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-132/212 | 753 | 759 | m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
| hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
| miR-329 | 1105 | 1111 | 1A | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
| miR-338 | 512 | 518 | 1A | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
| miR-34/449 | 1146 | 1153 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
| miR-544 | 346 | 352 | 1A | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.