Gene Page: ADAM19
Summary ?
GeneID | 8728 |
Symbol | ADAM19 |
Synonyms | FKSG34|MADDAM|MLTNB |
Description | ADAM metallopeptidase domain 19 |
Reference | MIM:603640|HGNC:HGNC:197|Ensembl:ENSG00000135074|HPRD:04704|Vega:OTTHUMG00000130242 |
Gene type | protein-coding |
Map location | 5q33.3 |
Pascal p-value | 0.386 |
Sherlock p-value | 0.399 |
Fetal beta | 0.726 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
CV:PheWAS | Phenome-wide association studies (PheWAS) | 157 SNPs associated with schizophrenia | 1 |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00459 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01718 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 1.1741 |
Section I. Genetics and epigenetics annotation
CV:PheWAS
SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
---|---|---|---|---|---|---|---|
rs2277027 | 5 | 156932376 | null | 1.553 | ADAM19 | null |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg17395226 | 5 | 156887490 | ADAM19 | 3.3E-9 | -0.031 | 2.2E-6 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6753473 | chr2 | 26526418 | ADAM19 | 8728 | 0.05 | trans | ||
rs16829545 | chr2 | 151977407 | ADAM19 | 8728 | 0.12 | trans | ||
rs16827037 | chr3 | 117203284 | ADAM19 | 8728 | 0.07 | trans | ||
rs16872030 | chr8 | 105937366 | ADAM19 | 8728 | 0.1 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
KDM5B | 0.97 | 0.97 |
ATF7IP | 0.96 | 0.97 |
RFX7 | 0.96 | 0.96 |
ZNF616 | 0.96 | 0.96 |
PBRM1 | 0.96 | 0.96 |
KDM1 | 0.95 | 0.96 |
KHDRBS1 | 0.95 | 0.98 |
UBTD2 | 0.95 | 0.95 |
OXSR1 | 0.95 | 0.95 |
PRRC1 | 0.95 | 0.94 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
HLA-F | -0.73 | -0.83 |
C5orf53 | -0.72 | -0.78 |
AIFM3 | -0.71 | -0.81 |
PTH1R | -0.69 | -0.77 |
ALDOC | -0.69 | -0.73 |
FBXO2 | -0.69 | -0.68 |
AF347015.31 | -0.69 | -0.91 |
S100B | -0.69 | -0.85 |
AF347015.27 | -0.69 | -0.89 |
TSC22D4 | -0.69 | -0.82 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004222 | metalloendopeptidase activity | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0017124 | SH3 domain binding | IEA | - | |
GO:0008233 | peptidase activity | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006508 | proteolysis | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PARENT MTOR SIGNALING DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP | 285 | 181 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP | 351 | 230 | All SZGR 2.0 genes in this pathway |
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 UP | 146 | 86 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN | 205 | 127 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D UP | 175 | 108 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 8HR UP | 164 | 122 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS UP | 126 | 72 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 UP | 120 | 73 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER HIGH RECURRENCE | 49 | 31 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION DN | 48 | 31 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
LA MEN1 TARGETS | 24 | 15 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
LEI HOXC8 TARGETS DN | 17 | 13 | All SZGR 2.0 genes in this pathway |
SWEET KRAS TARGETS UP | 84 | 51 | All SZGR 2.0 genes in this pathway |
PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
GUO HEX TARGETS DN | 65 | 36 | All SZGR 2.0 genes in this pathway |
KANG IMMORTALIZED BY TERT DN | 102 | 67 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION UP | 282 | 183 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN UP | 181 | 112 | All SZGR 2.0 genes in this pathway |
RAY TUMORIGENESIS BY ERBB2 CDC25A UP | 104 | 57 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D CLUSTER DN | 40 | 26 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF DN | 235 | 144 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN | 245 | 150 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS UP | 491 | 316 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA PCA3 DN | 69 | 38 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 DN | 45 | 30 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
WIEDERSCHAIN TARGETS OF BMI1 AND PCGF2 | 57 | 39 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
WANG MLL TARGETS | 289 | 188 | All SZGR 2.0 genes in this pathway |
FOSTER KDM1A TARGETS UP | 266 | 142 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 ISOFORM A | 182 | 108 | All SZGR 2.0 genes in this pathway |
BOSCO TH1 CYTOTOXIC MODULE | 114 | 62 | All SZGR 2.0 genes in this pathway |
ALTEMEIER RESPONSE TO LPS WITH MECHANICAL VENTILATION | 128 | 81 | All SZGR 2.0 genes in this pathway |
DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
NABA ECM REGULATORS | 238 | 125 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 3586 | 3592 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-128 | 2222 | 2228 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-145 | 3327 | 3334 | 1A,m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-153 | 3559 | 3566 | 1A,m8 | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-23 | 3465 | 3472 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-25/32/92/363/367 | 222 | 229 | 1A,m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-26 | 3569 | 3576 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-27 | 2222 | 2229 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-29 | 832 | 838 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU | ||||
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-30-5p | 3539 | 3546 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-323 | 3465 | 3471 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-378 | 1748 | 1754 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
miR-448 | 3560 | 3566 | 1A | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.