SZGR2

Summary ?

GeneID	9223
Symbol	MAGI1
Synonyms	AIP-3\|AIP3\|BAIAP1\|BAP-1\|BAP1\|MAGI-1\|Magi1d\|TNRC19\|WWP3
Description	membrane associated guanylate kinase, WW and PDZ domain containing 1
Reference	MIM:602625\|HGNC:HGNC:946\|Ensembl:ENSG00000151276\|HPRD:04020\|Vega:OTTHUMG00000157554
Gene type	protein-coding
Map location	3p14.1
Pascal p-value	0.651
Sherlock p-value	0.843
Fetal beta	-1.107
eGene	Putamen basal ganglia Myers' cis & trans Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	2	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs16955618	chr15	29937543	MAGI1	9223		0.18		trans
rs12488399	3	65216032	MAGI1	ENSG00000151276.19	5.29466E-7	0.01	808193	gtex_brain_putamen_basal
rs12488533	3	65216274	MAGI1	ENSG00000151276.19	3.00438E-7	0.01	807951	gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
DSP	0.87	0.66
CFH	0.86	0.61
OGN	0.86	0.59
GJB2	0.85	0.46
SCARA5	0.85	0.61
BNC2	0.83	0.48
SIX1	0.81	0.46
SIX2	0.79	0.36
SLC47A1	0.79	0.60
FOXC2	0.79	0.49

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
HES4	-0.24	-0.39
AC217773.2	-0.21	-0.30
FAM128A	-0.21	-0.34
MRPL41	-0.20	-0.10
C1orf61	-0.20	-0.27
NUDT8	-0.19	-0.30
NBR2	-0.19	-0.14
C7orf55	-0.19	-0.26
C9orf142	-0.18	-0.29
C16orf14	-0.18	-0.11

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0008022	protein C-terminus binding	TAS		9647739
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007155	cell adhesion	TAS		9647739
GO:0006461	protein complex assembly	NAS		9647739
GO:0007166	cell surface receptor linked signal transduction	TAS		9647739
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005923	tight junction	IEA	Brain (GO term level: 10)	-
GO:0005886	plasma membrane	TAS		9647739

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACCN3	ASIC3 \| DRASIC \| SLNAC1 \| TNaC1	amiloride-sensitive cation channel 3	-	HPRD,BioGRID	15317815
ACCN3	ASIC3 \| DRASIC \| SLNAC1 \| TNaC1	amiloride-sensitive cation channel 3	ASIC3 interacts with MAGI-1B.	BIND	15317815
ACTN4	ACTININ-4 \| DKFZp686K23158 \| FSGS \| FSGS1	actinin, alpha 4	-	HPRD,BioGRID	12042308
ATN1	B37 \| D12S755E \| DRPLA \| NOD	atrophin 1	Atrophin-1 interacts with AIP-3.	BIND	9647693
ATN1	B37 \| D12S755E \| DRPLA \| NOD	atrophin 1	-	HPRD,BioGRID	9647693
BAI1	FLJ41988	brain-specific angiogenesis inhibitor 1	-	HPRD,BioGRID	9647739
BZW1	BZAP45 \| KIAA0005 \| Nbla10236	basic leucine zipper and W2 domains 1	Affinity Capture-MS	BioGRID	17353931
CDH1	Arc-1 \| CD324 \| CDHE \| ECAD \| LCAM \| UVO	cadherin 1, type 1, E-cadherin (epithelial)	Affinity Capture-Western	BioGRID	10772923
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	10772923
DLL1	DELTA1 \| DL1 \| Delta	delta-like 1 (Drosophila)	Delta1 interacts with MAGI-1.	BIND	15509766
FCHSD2	KIAA0769 \| NWK \| SH3MD3	FCH and double SH3 domains 2	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	14627983
IL6R	CD126 \| IL-6R-1 \| IL-6R-alpha \| IL6RA \| MGC104991	interleukin 6 receptor	-	HPRD	9169421
LRP2	DBS \| gp330	low density lipoprotein-related protein 2	-	HPRD,BioGRID	11274227
NET1	ARHGEF8 \| NET1A	neuroepithelial cell transforming 1	-	HPRD,BioGRID	11350080
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	-	HPRD	9169421
SFN	YWHAS	stratifin	Affinity Capture-MS	BioGRID	15778465
SYNPO	KIAA1029	synaptopodin	-	HPRD,BioGRID	12042308
TP53BP2	53BP2 \| ASPP2 \| BBP \| PPP1R13A \| p53BP2	tumor protein p53 binding protein, 2	-	HPRD	9169421
WBP1	MGC15305 \| WBP-1	WW domain binding protein 1	Protein-peptide	BioGRID	9169421
WBP2	MGC18269 \| WBP-2	WW domain binding protein 2	Protein-peptide	BioGRID	9169421

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG TIGHT JUNCTION	134	86	All SZGR 2.0 genes in this pathway
RODRIGUES NTN1 TARGETS DN	158	102	All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP	269	146	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN	537	339	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
KIM MYC AMPLIFICATION TARGETS UP	201	127	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA MS UP	48	32	All SZGR 2.0 genes in this pathway
LEIN ASTROCYTE MARKERS	42	35	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP	271	165	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	1455	1462	1A,m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-153	1929	1935	m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-182	237	244	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-185	328	334	m8	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-188	255	262	1A,m8	hsa-miR-188	CAUCCCUUGCAUGGUGGAGGGU
miR-205	576	583	1A,m8	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-23	1628	1634	m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	1628	1634	m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-24	1315	1322	1A,m8	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-320	1959	1965	1A	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-323	1628	1634	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-34b	1306	1313	1A,m8	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-381	1587	1594	1A,m8	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-411	26	32	m8	hsa-miR-411	AACACGGUCCACUAACCCUCAGU
miR-496	1707	1713	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-96	238	244	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MAGI1