Gene Page: ZBTB22
Summary ?
| GeneID | 9278 |
| Symbol | ZBTB22 |
| Synonyms | BING1|ZBTB22A|ZNF297|ZNF297A|fru|fruitless |
| Description | zinc finger and BTB domain containing 22 |
| Reference | MIM:611439|HGNC:HGNC:13085|Ensembl:ENSG00000236104|HPRD:15761|Vega:OTTHUMG00000031110 |
| Gene type | protein-coding |
| Map location | 6p21.3 |
| Pascal p-value | 4.337E-8 |
| Sherlock p-value | 0.671 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.033 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| KIF13B | 0.92 | 0.84 |
| HSPA2 | 0.92 | 0.93 |
| GPRC5B | 0.92 | 0.89 |
| ERBB3 | 0.91 | 0.88 |
| DAAM2 | 0.91 | 0.92 |
| PADI2 | 0.91 | 0.88 |
| SHROOM4 | 0.90 | 0.83 |
| CNP | 0.90 | 0.87 |
| AC022100.1 | 0.90 | 0.87 |
| WIPF1 | 0.90 | 0.93 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| NR2C2AP | -0.55 | -0.67 |
| MED19 | -0.54 | -0.64 |
| POLB | -0.54 | -0.66 |
| TRNAU1AP | -0.53 | -0.61 |
| ALKBH2 | -0.52 | -0.66 |
| STMN1 | -0.52 | -0.58 |
| ING4 | -0.52 | -0.59 |
| AC009133.1 | -0.51 | -0.57 |
| CCDC28B | -0.51 | -0.68 |
| SCNM1 | -0.51 | -0.62 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | TAS | 9545376 | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0006350 | transcription | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | TAS | 9545376 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
| FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP | 151 | 100 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| LEE LIVER CANCER SURVIVAL UP | 185 | 112 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 7 | 76 | 46 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 1HR UP | 61 | 44 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP D | 280 | 158 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-381 | 121 | 128 | 1A,m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| miR-7 | 100 | 106 | m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.