|
|
| GeneID |
9581
|
| Symbol |
PREPL
|
| Synonyms |
FLJ16627|KIAA0436
|
| Description |
prolyl endopeptidase-like |
| See related |
HGNC:30228|MIM:609557|Ensembl:ENSG00000138078|HPRD:17189| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
2p21 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
| TTYH2 | 0.94 | 0.90 | | |
| ICOSLG | 0.94 | 0.90 | | |
| ATPGD1 | 0.94 | 0.94 | | |
| ABCA2 | 0.93 | 0.74 | | |
| PCTK3 | 0.93 | 0.94 | | |
| ERBB3 | 0.93 | 0.93 | | |
| LDB3 | 0.93 | 0.92 | | |
| C11orf9 | 0.92 | 0.94 | | |
| FA2H | 0.92 | 0.94 | | |
| CD22 | 0.92 | 0.92 | | |
Top 10 negatively co-expressed genes | | RPL12 | -0.47 | -0.77 | | |
| ALKBH2 | -0.47 | -0.76 | | |
| POLB | -0.47 | -0.76 | | |
| NKIRAS2 | -0.46 | -0.66 | | |
| MED19 | -0.46 | -0.74 | | |
| STMN1 | -0.46 | -0.73 | | |
| NR2C2AP | -0.46 | -0.76 | | |
| TRNAU1AP | -0.45 | -0.71 | | |
| IFT52 | -0.45 | -0.73 | | |
| HN1 | -0.45 | -0.71 | | |
|
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0004252 | serine-type endopeptidase activity | IEA | glutamate (GO term level: 7) | - |
| GO:0008233 | peptidase activity | IEA | | - |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0006508 | proteolysis | IEA | | - |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005737 | cytoplasm | IEA | | - |
| |
|
|
|
| miR-182 | 2067 | 2074 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA | | miR-31 | 2102 | 2109 | 1A,m8 | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCUG | | miR-96 | 2068 | 2074 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|