SZGR2

Summary ?

GeneID	9679
Symbol	FAM53B
Synonyms	KIAA0140\|bA12J10.2\|smp
Description	family with sequence similarity 53 member B
Reference	HGNC:HGNC:28968\|Ensembl:ENSG00000189319\|HPRD:13314\|Vega:OTTHUMG00000019215
Gene type	protein-coding
Map location	10q26.13
Pascal p-value	0.192
Sherlock p-value	0.659
DEG p-value	DEG:Zhao_2015:p=3.37e-04:q=0.0924
Fetal beta	0.294
eGene	Myers' cis & trans
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
DEG:Zhao_2015	RNA Sequencing analysis	Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder.
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.03487

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs1465923	chr4	77136210	FAM53B	9679		0.18		trans
rs7830259	chr8	14087643	FAM53B	9679		0.02		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C14orf153	0.88	0.87
FBXL2	0.86	0.84
KCTD2	0.86	0.86
AP2A2	0.85	0.81
LRSAM1	0.85	0.81
GPRASP2	0.85	0.78
TM2D3	0.85	0.80
GARS	0.84	0.78
OPTN	0.84	0.84
PRKRA	0.84	0.80

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.77	-0.64
MT-CO2	-0.77	-0.65
AF347015.8	-0.76	-0.64
AF347015.31	-0.75	-0.63
AF347015.2	-0.73	-0.62
MT-CYB	-0.73	-0.61
AF347015.33	-0.72	-0.59
AF347015.27	-0.72	-0.62
AF347015.15	-0.71	-0.61
AF347015.26	-0.69	-0.58

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003674	molecular_function	ND		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008150	biological_process	ND		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005575	cellular_component	ND		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER UP	206	111	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP	368	234	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP	380	236	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN	537	339	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN	261	155	All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER DN	160	110	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS DN	87	69	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP	244	165	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY UP	86	48	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C UP	47	29	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN	457	302	All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION	456	287	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
VANOEVELEN MYOGENESIS SIN3A TARGETS	220	133	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	3005	3011	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124.1	3005	3011	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	493	499	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-130/301	3869	3875	m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-185	499	505	m8	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-31	3505	3511	1A	hsa-miR-31	AGGCAAGAUGCUGGCAUAGCUG
miR-346	1285	1291	1A	hsa-miR-346^brain	UGUCUGCCCGCAUGCCUGCCUCU
miR-378	3893	3899	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: FAM53B