SZGR2

Summary ?

GeneID	9812
Symbol	KIAA0141
Synonyms	DELE
Description	KIAA0141
Reference	MIM:615741\|HGNC:HGNC:28969\|Ensembl:ENSG00000081791\|HPRD:13780\|Vega:OTTHUMG00000129662
Gene type	protein-coding
Map location	5q31.3
Pascal p-value	0.03
Sherlock p-value	1.327E-5
Fetal beta	0.335
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_I	Genome scan meta-analysis	Psr: 0.0032

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs16829545	chr2	151977407	KIAA0141	9812		0		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
DOC2A	0.79	0.84
CCKBR	0.78	0.83
SULT4A1	0.77	0.83
RND1	0.76	0.84
NRSN2	0.76	0.78
GFRA2	0.75	0.82
CHRM1	0.75	0.75
CRY2	0.74	0.77
ANKRD56	0.74	0.81
ANKRD34A	0.74	0.78

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
NSBP1	-0.44	-0.53
RAB13	-0.44	-0.55
PECI	-0.43	-0.44
AP002478.3	-0.41	-0.45
AF347015.18	-0.41	-0.39
C11orf67	-0.40	-0.46
C19orf18	-0.40	-0.45
AL139819.3	-0.40	-0.39
AF347015.21	-0.39	-0.31
GPR125	-0.38	-0.32

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005488	binding	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005739	mitochondrion	IDA		10942595

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PARENT MTOR SIGNALING UP	567	375	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
PUIFFE INVASION INHIBITED BY ASCITES UP	82	51	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP	372	227	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
GALE APL WITH FLT3 MUTATED UP	56	35	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA HP UP	49	26	All SZGR 2.0 genes in this pathway
HOEGERKORP CD44 TARGETS TEMPORAL DN	25	16	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD DN	150	93	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN	298	200	All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC DN	228	146	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 UP	167	99	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway
ZWANG EGF INTERVAL DN	214	124	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-146	831	837	1A	hsa-miR-146a	UGAGAACUGAAUUCCAUGGGUU
miR-146	831	837	1A	hsa-miR-146b^brain	UGAGAACUGAAUUCCAUAGGCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: KIAA0141