Gene Page: C2CD2L
Summary ?
| GeneID | 9854 |
| Symbol | C2CD2L |
| Synonyms | DLNB23|TMEM24 |
| Description | C2CD2 like |
| Reference | HGNC:HGNC:29000|Ensembl:ENSG00000172375|HPRD:15533|Vega:OTTHUMG00000166167 |
| Gene type | protein-coding |
| Map location | 11q23.3 |
| Pascal p-value | 0.057 |
| Sherlock p-value | 0.338 |
| DEG p-value | DEG:Maycox_2009:CC_BA10_fold_change=-1.22:CC_BA10_disease_P=0.0027:HBB_BA9_fold_change=-1.44:HBB_BA9_disease_P=0.0002 |
| Fetal beta | -1.452 |
| Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DEG:Maycox_2009 | Microarray to determine the expression of over 30000 mRNA transcripts in post-mortem tissue | We included 51 genes whose expression changes are common between two schizophrenia cohorts. |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003674 | molecular_function | ND | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008150 | biological_process | ND | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005575 | cellular_component | ND | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 3 4WK UP | 214 | 144 | All SZGR 2.0 genes in this pathway |
| EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
| DAIRKEE TERT TARGETS DN | 124 | 79 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 6HR UP | 71 | 48 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
| KASLER HDAC7 TARGETS 1 UP | 194 | 133 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-138 | 502 | 508 | 1A | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
| miR-150 | 788 | 795 | 1A,m8 | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
| miR-185 | 410 | 416 | m8 | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
| miR-26 | 643 | 649 | m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
| miR-377 | 815 | 821 | m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
| miR-491 | 579 | 585 | m8 | hsa-miR-491brain | AGUGGGGAACCCUUCCAUGAGGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.