Gene Page: CDC5L
Summary ?
| GeneID | 988 |
| Symbol | CDC5L |
| Synonyms | CDC5|CDC5-LIKE|CEF1|PCDC5RP|dJ319D22.1 |
| Description | cell division cycle 5 like |
| Reference | MIM:602868|HGNC:HGNC:1743|Ensembl:ENSG00000096401|HPRD:04184|Vega:OTTHUMG00000014767 |
| Gene type | protein-coding |
| Map location | 6p21 |
| Pascal p-value | 0.261 |
| Sherlock p-value | 0.345 |
| Fetal beta | 1.339 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0114 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg15773716 | 6 | 44355950 | CDC5L | 1.84E-5 | -0.36 | 0.016 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs2207105 | chr20 | 11231352 | CDC5L | 988 | 0.12 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| CHEK1 | 0.93 | 0.79 |
| TIMELESS | 0.92 | 0.81 |
| GINS1 | 0.91 | 0.80 |
| DEPDC1B | 0.91 | 0.78 |
| MCM2 | 0.91 | 0.84 |
| GINS2 | 0.91 | 0.73 |
| FBXO5 | 0.91 | 0.81 |
| DTL | 0.90 | 0.80 |
| WEE1 | 0.90 | 0.80 |
| RRM1 | 0.90 | 0.84 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C5orf53 | -0.55 | -0.74 |
| HLA-F | -0.54 | -0.71 |
| AF347015.27 | -0.51 | -0.78 |
| PTH1R | -0.51 | -0.66 |
| ASPHD1 | -0.51 | -0.57 |
| FBXO2 | -0.51 | -0.59 |
| AF347015.31 | -0.51 | -0.77 |
| CA4 | -0.51 | -0.69 |
| SLC16A11 | -0.50 | -0.61 |
| MT-CO2 | -0.50 | -0.79 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | NAS | 8917598 | |
| GO:0003723 | RNA binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 15232106 |17353931 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006355 | regulation of transcription, DNA-dependent | NAS | - | |
| GO:0006397 | mRNA processing | IEA | - | |
| GO:0008380 | RNA splicing | IEA | - | |
| GO:0007049 | cell cycle | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | NAS | - | |
| GO:0005681 | spliceosome | IEA | - | |
| GO:0005730 | nucleolus | IDA | 18029348 | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0016607 | nuclear speck | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG SPLICEOSOME | 128 | 72 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 6HR UP | 55 | 34 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
| XU AKT1 TARGETS 6HR | 27 | 18 | All SZGR 2.0 genes in this pathway |
| MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
| JIANG AGING CEREBRAL CORTEX UP | 36 | 27 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| YAMAZAKI TCEB3 TARGETS DN | 215 | 132 | All SZGR 2.0 genes in this pathway |
| MA PITUITARY FETAL VS ADULT UP | 29 | 21 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 18HR UP | 178 | 111 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 24HR UP | 148 | 96 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RESPONSE TO TRABECTEDIN DN | 271 | 175 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
| ALONSO METASTASIS UP | 198 | 128 | All SZGR 2.0 genes in this pathway |
| ICHIBA GRAFT VERSUS HOST DISEASE D7 DN | 40 | 22 | All SZGR 2.0 genes in this pathway |
| HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
| OKAMOTO LIVER CANCER MULTICENTRIC OCCURRENCE UP | 25 | 15 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
| PASINI SUZ12 TARGETS UP | 112 | 65 | All SZGR 2.0 genes in this pathway |
| YU BAP1 TARGETS | 29 | 21 | All SZGR 2.0 genes in this pathway |
| RAO BOUND BY SALL4 ISOFORM A | 182 | 108 | All SZGR 2.0 genes in this pathway |
| PECE MAMMARY STEM CELL DN | 146 | 88 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-186 | 213 | 219 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.