|
|
| GeneID |
10107
|
| Symbol |
TRIM10
|
| Synonyms |
HERF1|MGC141979|RFB30|RNF9
|
| Description |
tripartite motif-containing 10 |
| See related |
HGNC:10072|MIM:605701|Ensembl:ENSG00000204613|HPRD:05752| |
| Locus tag |
DAAP-200B17.4 |
| Gene type |
protein-coding |
| Map location |
6p21.3 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GSMA_I | genome scan meta-analysis | Psr: 0.033 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
| CREB3L1 | 0.69 | 0.73 | | |
| SUOX | 0.69 | 0.65 | | |
| ADCY2 | 0.68 | 0.70 | | |
| CCDC3 | 0.68 | 0.72 | | |
| CCKBR | 0.66 | 0.69 | | |
| SERPINE2 | 0.65 | 0.67 | | |
| ETV5 | 0.65 | 0.71 | | |
| OLFML2B | 0.64 | 0.70 | | |
| CHRM1 | 0.64 | 0.68 | | |
| ZDHHC8 | 0.64 | 0.64 | | |
Top 10 negatively co-expressed genes | | C21orf57 | -0.46 | -0.45 | | |
| FAM159B | -0.45 | -0.50 | | |
| EIF5B | -0.41 | -0.39 | | |
| RP9P | -0.38 | -0.39 | | |
| AL050337.1 | -0.38 | -0.28 | | |
| AC011475.1 | -0.38 | -0.35 | | |
| CWF19L2 | -0.38 | -0.33 | | |
| AC098691.2 | -0.38 | -0.27 | | |
| RBMX2 | -0.36 | -0.34 | | |
| NSBP1 | -0.36 | -0.32 | | |
|
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005515 | protein binding | IEA | | - |
| GO:0008270 | zinc ion binding | IEA | | - |
| GO:0008270 | zinc ion binding | NAS | | - |
| GO:0046872 | metal ion binding | IEA | | - |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0030097 | hemopoiesis | NAS | | - |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005622 | intracellular | IEA | | - |
| GO:0005622 | intracellular | NAS | | - |
| GO:0005737 | cytoplasm | IEA | | - |
| |
|
|
| |
|
|
| miR-7 | 104 | 110 | 1A | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|