Gene Page: TRIM10
Summary ?
| GeneID | 10107 |
| Symbol | TRIM10 |
| Synonyms | HERF1|RFB30|RNF9 |
| Description | tripartite motif containing 10 |
| Reference | MIM:605701|HGNC:HGNC:10072|Ensembl:ENSG00000204613|HPRD:05752|Vega:OTTHUMG00000031295 |
| Gene type | protein-coding |
| Map location | 6p21.3 |
| Pascal p-value | 1E-12 |
| Fetal beta | -0.242 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| CREB3L1 | 0.69 | 0.73 |
| SUOX | 0.69 | 0.65 |
| ADCY2 | 0.68 | 0.70 |
| CCDC3 | 0.68 | 0.72 |
| CCKBR | 0.66 | 0.69 |
| SERPINE2 | 0.65 | 0.67 |
| ETV5 | 0.65 | 0.71 |
| OLFML2B | 0.64 | 0.70 |
| CHRM1 | 0.64 | 0.68 |
| ZDHHC8 | 0.64 | 0.64 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C21orf57 | -0.46 | -0.45 |
| FAM159B | -0.45 | -0.50 |
| EIF5B | -0.41 | -0.39 |
| RP9P | -0.38 | -0.39 |
| AL050337.1 | -0.38 | -0.28 |
| AC011475.1 | -0.38 | -0.35 |
| CWF19L2 | -0.38 | -0.33 |
| AC098691.2 | -0.38 | -0.27 |
| RBMX2 | -0.36 | -0.34 |
| NSBP1 | -0.36 | -0.32 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0008270 | zinc ion binding | NAS | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0030097 | hemopoiesis | NAS | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005622 | intracellular | NAS | - | |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| INGRAM SHH TARGETS UP | 127 | 79 | All SZGR 2.0 genes in this pathway |
| LEE AGING NEOCORTEX DN | 80 | 49 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| VALK AML CLUSTER 7 | 28 | 16 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
| CHYLA CBFA2T3 TARGETS DN | 242 | 146 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
| TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-7 | 104 | 110 | 1A | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.