Gene Page: ARPC2
Summary ?
GeneID | 10109 |
Symbol | ARPC2 |
Synonyms | ARC34|PNAS-139|PRO2446|p34-Arc |
Description | actin related protein 2/3 complex subunit 2 |
Reference | MIM:604224|HGNC:HGNC:705|Ensembl:ENSG00000163466|HPRD:10367|Vega:OTTHUMG00000133618 |
Gene type | protein-coding |
Map location | 2q36.1 |
Pascal p-value | 0.706 |
Sherlock p-value | 0.349 |
Fetal beta | -0.001 |
DMG | 1 (# studies) |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanNRC CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg08216808 | 2 | 219081385 | ARPC2 | 2.281E-4 | 0.436 | 0.036 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003779 | actin binding | IEA | - | |
GO:0005515 | protein binding | IPI | 17350576 |17353931 | |
GO:0005200 | structural constituent of cytoskeleton | TAS | 9230079 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006928 | cell motion | TAS | 9230079 | |
GO:0030833 | regulation of actin filament polymerization | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0042995 | cell projection | IEA | axon (GO term level: 4) | - |
GO:0005856 | cytoskeleton | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005885 | Arp2/3 protein complex | TAS | 9230079 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS | 97 | 71 | All SZGR 2.0 genes in this pathway |
KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
KEGG PATHOGENIC ESCHERICHIA COLI INFECTION | 59 | 36 | All SZGR 2.0 genes in this pathway |
BIOCARTA SALMONELLA PATHWAY | 13 | 10 | All SZGR 2.0 genes in this pathway |
BIOCARTA MPR PATHWAY | 34 | 28 | All SZGR 2.0 genes in this pathway |
BIOCARTA RHO PATHWAY | 32 | 23 | All SZGR 2.0 genes in this pathway |
BIOCARTA CDC42RAC PATHWAY | 16 | 13 | All SZGR 2.0 genes in this pathway |
BIOCARTA ACTINY PATHWAY | 20 | 14 | All SZGR 2.0 genes in this pathway |
PID CDC42 PATHWAY | 70 | 51 | All SZGR 2.0 genes in this pathway |
PID ERBB1 DOWNSTREAM PATHWAY | 105 | 78 | All SZGR 2.0 genes in this pathway |
PID PDGFRB PATHWAY | 129 | 103 | All SZGR 2.0 genes in this pathway |
PID RAC1 PATHWAY | 54 | 37 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
LAIHO COLORECTAL CANCER SERRATED UP | 112 | 71 | All SZGR 2.0 genes in this pathway |
WANG CLIM2 TARGETS DN | 186 | 114 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
DITTMER PTHLH TARGETS DN | 73 | 51 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
VETTER TARGETS OF PRKCA AND ETS1 DN | 16 | 10 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
LIU NASOPHARYNGEAL CARCINOMA | 70 | 38 | All SZGR 2.0 genes in this pathway |
IIZUKA LIVER CANCER PROGRESSION L0 L1 DN | 21 | 14 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
BANDRES RESPONSE TO CARMUSTIN MGMT 24HR DN | 33 | 21 | All SZGR 2.0 genes in this pathway |
BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN | 161 | 105 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING | 246 | 152 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
ROSS LEUKEMIA WITH MLL FUSIONS | 78 | 49 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
KYNG WERNER SYNDROM AND NORMAL AGING DN | 225 | 124 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS DURATION CORR DN | 146 | 90 | All SZGR 2.0 genes in this pathway |
JUBAN TARGETS OF SPI1 AND FLI1 DN | 92 | 60 | All SZGR 2.0 genes in this pathway |
HOLLEMAN PREDNISOLONE RESISTANCE ALL DN | 11 | 8 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-25/32/92/363/367 | 300 | 306 | 1A | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-382 | 224 | 230 | 1A | hsa-miR-382brain | GAAGUUGUUCGUGGUGGAUUCG |
miR-544 | 147 | 154 | 1A,m8 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.