Gene Page: SPRY2
Summary ?
GeneID | 10253 |
Symbol | SPRY2 |
Synonyms | IGAN3|hSPRY2 |
Description | sprouty RTK signaling antagonist 2 |
Reference | MIM:602466|HGNC:HGNC:11270|Ensembl:ENSG00000136158|HPRD:03916|Vega:OTTHUMG00000017140 |
Gene type | protein-coding |
Map location | 13q31.1 |
Pascal p-value | 0.613 |
Sherlock p-value | 0.472 |
Fetal beta | -0.452 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SLC25A39 | 0.88 | 0.88 |
SHARPIN | 0.86 | 0.86 |
GPS1 | 0.86 | 0.85 |
VKORC1 | 0.85 | 0.81 |
GSTP1 | 0.85 | 0.81 |
SH3BGRL3 | 0.84 | 0.84 |
COPE | 0.84 | 0.85 |
COQ4 | 0.83 | 0.82 |
GNB2 | 0.82 | 0.78 |
MRPS2 | 0.81 | 0.79 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.27 | -0.52 | -0.57 |
AF347015.8 | -0.51 | -0.55 |
MT-CYB | -0.50 | -0.55 |
AF347015.31 | -0.50 | -0.53 |
MT-CO2 | -0.50 | -0.53 |
MT-ATP8 | -0.49 | -0.60 |
AF347015.33 | -0.49 | -0.53 |
AF347015.2 | -0.48 | -0.54 |
AF347015.15 | -0.47 | -0.52 |
AF347015.26 | -0.46 | -0.52 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0009966 | regulation of signal transduction | IEA | - | |
GO:0007267 | cell-cell signaling | TAS | 9458049 | |
GO:0009887 | organ morphogenesis | TAS | 9458049 | |
GO:0007605 | sensory perception of sound | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0042472 | inner ear morphogenesis | IEA | - | |
GO:0048754 | branching morphogenesis of a tube | IEA | - | |
GO:0030324 | lung development | IEA | - | |
GO:0043407 | negative regulation of MAP kinase activity | IEA | - | |
GO:0045165 | cell fate commitment | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005829 | cytosol | EXP | 12593796 | |
GO:0005874 | microtubule | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005886 | plasma membrane | EXP | 15962011 | |
GO:0005886 | plasma membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ADAMTSL4 | TSRC1 | ADAMTS-like 4 | Two-hybrid | BioGRID | 16189514 |
CBL | C-CBL | CBL2 | RNF55 | Cas-Br-M (murine) ecotropic retroviral transforming sequence | - | HPRD,BioGRID | 11053437 |12234920 |
CBL | C-CBL | CBL2 | RNF55 | Cas-Br-M (murine) ecotropic retroviral transforming sequence | c-Cbl interacts with hSpry2. This interaction was modeled on a demonstrated interaction between c-Cbl from an unspecified species and human hSpry2. | BIND | 12234920 |
CBL | C-CBL | CBL2 | RNF55 | Cas-Br-M (murine) ecotropic retroviral transforming sequence | SPRY2 interacts with c-Cbl. | BIND | 11053437 |
CBL | C-CBL | CBL2 | RNF55 | Cas-Br-M (murine) ecotropic retroviral transforming sequence | hSpry2 interacts with c-Cbl. | BIND | 12815057 |
CBLB | DKFZp686J10223 | DKFZp779A0729 | DKFZp779F1443 | FLJ36865 | FLJ41152 | Nbla00127 | RNF56 | Cas-Br-M (murine) ecotropic retroviral transforming sequence b | SPRY2 interacts with Cbl-b. | BIND | 11053437 |
CBLC | CBL-3 | CBL-SL | RNF57 | Cas-Br-M (murine) ecotropic retroviral transforming sequence c | - | HPRD | 12234920 |
GPRIN2 | GRIN2 | KIAA0514 | MGC15171 | G protein regulated inducer of neurite outgrowth 2 | Two-hybrid | BioGRID | 16189514 |
GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD,BioGRID | 10940627 |12402043 |
KRTAP4-12 | KAP4.12 | KRTAP4.12 | keratin associated protein 4-12 | Two-hybrid | BioGRID | 16189514 |
PLSCR1 | MMTRA1B | phospholipid scramblase 1 | Two-hybrid | BioGRID | 16189514 |
RAF1 | CRAF | NS5 | Raf-1 | c-Raf | v-raf-1 murine leukemia viral oncogene homolog 1 | Affinity Capture-Western | BioGRID | 12717443 |
SPRYD5 | MGC10977 | TRIM51 | SPRY domain containing 5 | Two-hybrid | BioGRID | 16189514 |
TRAF2 | MGC:45012 | TRAP | TRAP3 | TNF receptor-associated factor 2 | Two-hybrid | BioGRID | 16189514 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG JAK STAT SIGNALING PATHWAY | 155 | 105 | All SZGR 2.0 genes in this pathway |
BIOCARTA SPRY PATHWAY | 18 | 15 | All SZGR 2.0 genes in this pathway |
PID PTP1B PATHWAY | 52 | 40 | All SZGR 2.0 genes in this pathway |
PID ERBB1 INTERNALIZATION PATHWAY | 41 | 35 | All SZGR 2.0 genes in this pathway |
PID FGF PATHWAY | 55 | 37 | All SZGR 2.0 genes in this pathway |
REACTOME SPRY REGULATION OF FGF SIGNALING | 14 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME NEGATIVE REGULATION OF FGFR SIGNALING | 37 | 24 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY EGFR IN CANCER | 109 | 80 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY FGFR IN DISEASE | 127 | 88 | All SZGR 2.0 genes in this pathway |
REACTOME EGFR DOWNREGULATION | 25 | 14 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY FGFR | 112 | 80 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP | 177 | 110 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP | 233 | 161 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS TURQUOISE UP | 79 | 50 | All SZGR 2.0 genes in this pathway |
LEE NEURAL CREST STEM CELL DN | 118 | 79 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA DN | 284 | 156 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS UP | 214 | 155 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS UP | 194 | 112 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 3 DN | 229 | 142 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN DN | 172 | 112 | All SZGR 2.0 genes in this pathway |
AMUNDSON GENOTOXIC SIGNATURE | 105 | 68 | All SZGR 2.0 genes in this pathway |
DAWSON METHYLATED IN LYMPHOMA TCL1 | 59 | 45 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 DN | 156 | 106 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA HIF1A DN | 110 | 78 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 AND HIF1A UP | 142 | 104 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP | 236 | 139 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA MS UP | 48 | 32 | All SZGR 2.0 genes in this pathway |
WEIGEL OXIDATIVE STRESS BY HNE AND H2O2 | 39 | 29 | All SZGR 2.0 genes in this pathway |
HENDRICKS SMARCA4 TARGETS DN | 53 | 34 | All SZGR 2.0 genes in this pathway |
XU GH1 EXOGENOUS TARGETS DN | 120 | 69 | All SZGR 2.0 genes in this pathway |
MARTINEZ RESPONSE TO TRABECTEDIN DN | 271 | 175 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
BASSO HAIRY CELL LEUKEMIA DN | 80 | 66 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
LEE SP4 THYMOCYTE | 14 | 11 | All SZGR 2.0 genes in this pathway |
LEE RECENT THYMIC EMIGRANT | 227 | 128 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
FOURNIER ACINAR DEVELOPMENT LATE 2 | 277 | 172 | All SZGR 2.0 genes in this pathway |
NIELSEN LEIOMYOSARCOMA CNN1 DN | 20 | 18 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE DN | 103 | 67 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
BILANGES SERUM AND RAPAMYCIN SENSITIVE GENES | 68 | 35 | All SZGR 2.0 genes in this pathway |
WINZEN DEGRADED VIA KHSRP | 100 | 70 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 | 227 | 149 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 494 | 500 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 494 | 500 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-128 | 382 | 388 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-21 | 236 | 243 | 1A,m8 | hsa-miR-21brain | UAGCUUAUCAGACUGAUGUUGA |
hsa-miR-590 | GAGCUUAUUCAUAAAAGUGCAG | ||||
miR-23 | 458 | 465 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-27 | 382 | 389 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-323 | 458 | 464 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-326 | 337 | 343 | 1A | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
miR-369-3p | 428 | 434 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 428 | 434 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-378 | 10 | 16 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
miR-381 | 359 | 365 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.