Gene Page: DNAJA2
Summary ?
| GeneID | 10294 |
| Symbol | DNAJA2 |
| Synonyms | CPR3|DJ3|DJA2|DNAJ|DNJ3|HIRIP4|PRO3015|RDJ2 |
| Description | DnaJ heat shock protein family (Hsp40) member A2 |
| Reference | MIM:611322|HGNC:HGNC:14884|Ensembl:ENSG00000069345|HPRD:07105|Vega:OTTHUMG00000133104 |
| Gene type | protein-coding |
| Map location | 16q12.1 |
| Pascal p-value | 0.077 |
| Sherlock p-value | 0.338 |
| Fetal beta | -1.117 |
| DMG | 1 (# studies) |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg18206040 | 16 | 47006731 | DNAJA2 | 0.003 | -5.308 | DMG:vanEijk_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0031072 | heat shock protein binding | IEA | - | |
| GO:0051082 | unfolded protein binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006457 | protein folding | IEA | - | |
| GO:0008284 | positive regulation of cell proliferation | TAS | 9383053 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| BOGNI TREATMENT RELATED MYELOID LEUKEMIA UP | 30 | 19 | All SZGR 2.0 genes in this pathway |
| ROYLANCE BREAST CANCER 16Q COPY NUMBER DN | 26 | 19 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| SHEPARD BMYB MORPHOLINO UP | 205 | 126 | All SZGR 2.0 genes in this pathway |
| BROCKE APOPTOSIS REVERSED BY IL6 | 144 | 98 | All SZGR 2.0 genes in this pathway |
| JIANG AGING HYPOTHALAMUS DN | 40 | 31 | All SZGR 2.0 genes in this pathway |
| WANG CISPLATIN RESPONSE AND XPC DN | 228 | 146 | All SZGR 2.0 genes in this pathway |
| CHANG IMMORTALIZED BY HPV31 UP | 84 | 55 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RESPONSE TO TRABECTEDIN DN | 271 | 175 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
| BONCI TARGETS OF MIR15A AND MIR16 1 | 91 | 75 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-132/212 | 196 | 202 | m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
| hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
| miR-15/16/195/424/497 | 402 | 408 | 1A | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-19 | 471 | 478 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-26 | 220 | 226 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
| miR-320 | 177 | 183 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
| miR-376c | 114 | 121 | 1A,m8 | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
| miR-493-5p | 357 | 363 | 1A | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-494 | 317 | 324 | 1A,m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
| miR-503 | 402 | 408 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
| miR-93.hd/291-3p/294/295/302/372/373/520 | 217 | 223 | m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
| hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
| hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
| hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
| hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
| hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
| hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
| hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
| hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
| hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
| hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
| hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.