Gene Page: CDIPT
Summary ?
| GeneID | 10423 |
| Symbol | CDIPT |
| Synonyms | PIS|PIS1 |
| Description | CDP-diacylglycerol--inositol 3-phosphatidyltransferase |
| Reference | MIM:605893|HGNC:HGNC:1769|Ensembl:ENSG00000103502|HPRD:12063|Vega:OTTHUMG00000177144 |
| Gene type | protein-coding |
| Map location | 16p11.2 |
| Pascal p-value | 0.01 |
| Sherlock p-value | 0.408 |
| Fetal beta | -0.606 |
| eGene | Cerebellum |
| Support | G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CNV:YES | Copy number variation studies | Manual curation | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| U2AF2 | 0.95 | 0.96 |
| STRN4 | 0.95 | 0.97 |
| MEN1 | 0.95 | 0.95 |
| RBM15B | 0.94 | 0.96 |
| EHMT2 | 0.94 | 0.94 |
| MAZ | 0.93 | 0.93 |
| WIZ | 0.93 | 0.94 |
| DCAF15 | 0.93 | 0.95 |
| DVL3 | 0.93 | 0.94 |
| SARM1 | 0.93 | 0.96 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.78 | -0.88 |
| AF347015.27 | -0.78 | -0.89 |
| MT-CO2 | -0.77 | -0.89 |
| AF347015.33 | -0.77 | -0.88 |
| MT-CYB | -0.75 | -0.86 |
| AF347015.8 | -0.74 | -0.88 |
| S100B | -0.74 | -0.84 |
| FXYD1 | -0.73 | -0.83 |
| HLA-F | -0.72 | -0.76 |
| AF347015.15 | -0.72 | -0.85 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000287 | magnesium ion binding | IEA | - | |
| GO:0003881 | CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity | IEA | - | |
| GO:0016780 | phosphotransferase activity, for other substituted phosphate groups | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| GO:0008526 | phosphatidylinositol transporter activity | TAS | 9407135 | |
| GO:0030145 | manganese ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008654 | phospholipid biosynthetic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000139 | Golgi membrane | IEA | - | |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
| GO:0005783 | endoplasmic reticulum | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG INOSITOL PHOSPHATE METABOLISM | 54 | 42 | All SZGR 2.0 genes in this pathway |
| KEGG GLYCEROPHOSPHOLIPID METABOLISM | 77 | 35 | All SZGR 2.0 genes in this pathway |
| KEGG PHOSPHATIDYLINOSITOL SIGNALING SYSTEM | 76 | 56 | All SZGR 2.0 genes in this pathway |
| REACTOME PHOSPHOLIPID METABOLISM | 198 | 112 | All SZGR 2.0 genes in this pathway |
| REACTOME GLYCEROPHOSPHOLIPID BIOSYNTHESIS | 82 | 39 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
| SCIBETTA KDM5B TARGETS UP | 19 | 12 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| JAZAG TGFB1 SIGNALING VIA SMAD4 UP | 108 | 66 | All SZGR 2.0 genes in this pathway |
| FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP | 151 | 100 | All SZGR 2.0 genes in this pathway |
| THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
| WANG CISPLATIN RESPONSE AND XPC DN | 228 | 146 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS DURATION CORR DN | 146 | 90 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-214 | 116 | 122 | m8 | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.