SZGR2

Summary ?

GeneID	10746
Symbol	MAP3K2
Synonyms	MEKK2\|MEKK2B
Description	mitogen-activated protein kinase kinase kinase 2
Reference	MIM:609487\|HGNC:HGNC:6854\|Ensembl:ENSG00000169967\|HPRD:10068\|Vega:OTTHUMG00000153397
Gene type	protein-coding
Map location	2q14.3
Pascal p-value	0.985
Sherlock p-value	0.023
Fetal beta	0.874
eGene	Myers' cis & trans Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
GSMA_I	Genome scan meta-analysis	Psr: 0.023
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00755

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs2404535	chr2	127947708	MAP3K2	10746	0.14	cis
rs7585198	chr2	127962634	MAP3K2	10746	0	cis
rs12463909	chr2	127971737	MAP3K2	10746	0.01	cis
rs4150477	chr2	128032545	MAP3K2	10746	0.04	cis
rs6710535	chr2	128190959	MAP3K2	10746	0.03	cis
rs7585198	chr2	127962634	MAP3K2	10746	0.13	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PYGO2	0.85	0.87
MAGED1	0.85	0.87
KIAA1539	0.82	0.83
AC069234.1	0.82	0.87
ZMYM3	0.82	0.86
VAC14	0.81	0.85
C7orf43	0.81	0.85
EFNB3	0.81	0.85
LRRN2	0.81	0.85
RGMB	0.81	0.84

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MT-CO2	-0.68	-0.73
AF347015.8	-0.66	-0.73
AF347015.31	-0.66	-0.70
AF347015.21	-0.66	-0.76
AF347015.2	-0.65	-0.70
MT-CYB	-0.64	-0.68
AF347015.33	-0.63	-0.68
AF347015.27	-0.63	-0.69
AF347015.15	-0.62	-0.67
AF347015.26	-0.62	-0.68

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0000287	magnesium ion binding	IEA		-
GO:0005515	protein binding	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0004672	protein kinase activity	IEA		-
GO:0004674	protein serine/threonine kinase activity	TAS		8621389
GO:0004709	MAP kinase kinase kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0007257	activation of JNK activity	TAS		8621389
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
MAP2K4	JNKK \| JNKK1 \| MAPKK4 \| MEK4 \| MKK4 \| PRKMK4 \| SEK1 \| SERK1	mitogen-activated protein kinase kinase 4	-	HPRD	7997270
MAP2K5	HsT17454 \| MAPKK5 \| MEK5 \| PRKMK5	mitogen-activated protein kinase kinase 5	Affinity Capture-Western Two-hybrid	BioGRID	11073940
MAP2K5	HsT17454 \| MAPKK5 \| MEK5 \| PRKMK5	mitogen-activated protein kinase kinase 5	MEKK2 phosphorylates an unspecified isoform of MEK5. This interaction was modeled on a demonstrated interaction between MEKK2 from an unspecified species and MEK5 from an unspecified species.	BIND	12659851
MAP2K7	Jnkk2 \| MAPKK7 \| MKK7 \| PRKMK7	mitogen-activated protein kinase kinase 7	MEKK2 phosphorylates MKK7. This interaction was modeled on a demonstrated interaction between MEKK2 from an unspecified species and MKK7 from an unspecified species.	BIND	12659851
MAP2K7	Jnkk2 \| MAPKK7 \| MKK7 \| PRKMK7	mitogen-activated protein kinase kinase 7	-	HPRD,BioGRID	10713157
MAP3K2	MEKK2 \| MEKK2B	mitogen-activated protein kinase kinase kinase 2	MEKK2 autophosphorylates. This interaction was modeled on a demonstrated interaction of MEKK2 from an unspecified species.	BIND	12659851
MAP3K5	ASK1 \| MAPKKK5 \| MEKK5	mitogen-activated protein kinase kinase kinase 5	-	HPRD	12912994
MAPK8	JNK \| JNK1 \| JNK1A2 \| JNK21B1/2 \| PRKM8 \| SAPK1	mitogen-activated protein kinase 8	-	HPRD,BioGRID	10713157
PKN2	MGC150606 \| MGC71074 \| PAK2 \| PRK2 \| PRKCL2 \| PRO2042 \| Pak-2	protein kinase N2	-	HPRD,BioGRID	10818102
SFN	YWHAS	stratifin	Affinity Capture-MS	BioGRID	15778465
SH2D2A	F2771 \| TSAd	SH2 domain protein 2A	Affinity Capture-Western Two-hybrid	BioGRID	11073940
YWHAE	14-3-3E \| FLJ45465 \| KCIP-1 \| MDCR \| MDS	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide	-	HPRD,BioGRID	9452471
YWHAG	14-3-3GAMMA	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide	-	HPRD	15324660
YWHAZ	KCIP-1 \| MGC111427 \| MGC126532 \| MGC138156	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide	-	HPRD	9452471

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG GAP JUNCTION	90	68	All SZGR 2.0 genes in this pathway
KEGG GNRH SIGNALING PATHWAY	101	77	All SZGR 2.0 genes in this pathway
BIOCARTA MAPK PATHWAY	87	68	All SZGR 2.0 genes in this pathway
ST JNK MAPK PATHWAY	40	30	All SZGR 2.0 genes in this pathway
PID ERBB1 DOWNSTREAM PATHWAY	105	78	All SZGR 2.0 genes in this pathway
PID MAPK TRK PATHWAY	34	31	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP	404	246	All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN	275	168	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE DN	54	38	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP	195	138	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE S	162	86	All SZGR 2.0 genes in this pathway
STAMBOLSKY TARGETS OF MUTATED TP53 UP	49	35	All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS	289	187	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
LINSLEY MIR16 TARGETS	206	127	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN	106	77	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
RATTENBACHER BOUND BY CELF1	467	251	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-10	2407	2413	1A	hsa-miR-10a	UACCCUGUAGAUCCGAAUUUGUG
miR-10	2407	2413	1A	hsa-miR-10b	UACCCUGUAGAACCGAAUUUGU
miR-122	2868	2874	m8	hsa-miR-122a	UGGAGUGUGACAAUGGUGUUUGU
miR-129-5p	2763	2769	1A	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	2763	2769	1A	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-17-5p/20/93.mr/106/519.d	65	71	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
				hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-186	522	529	1A,m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-223	346	352	1A	hsa-miR-223	UGUCAGUUUGUCAAAUACCCC
miR-23	2686	2692	1A	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	2686	2692	1A	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-26	208	214	1A	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	208	214	1A	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-335	128	134	1A	hsa-miR-335^brain	UCAAGAGCAAUAACGAAAAAUGU
miR-539	124	130	m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MAP3K2