Gene Page: HSPH1
Summary ?
| GeneID | 10808 |
| Symbol | HSPH1 |
| Synonyms | HSP105|HSP105A|HSP105B|NY-CO-25 |
| Description | heat shock protein family H (Hsp110) member 1 |
| Reference | MIM:610703|HGNC:HGNC:16969|Ensembl:ENSG00000120694|HPRD:09990|Vega:OTTHUMG00000016685 |
| Gene type | protein-coding |
| Map location | 13q12.3 |
| Pascal p-value | 0.043 |
| eGene | Myers' cis & trans |
| Support | RNA AND PROTEIN SYNTHESIS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs17076954 | chr13 | 32516173 | HSPH1 | 10808 | 0.02 | cis | ||
| rs6049703 | chr20 | 24432425 | HSPH1 | 10808 | 0.04 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FBXL16 | 0.89 | 0.92 |
| CYP46A1 | 0.87 | 0.82 |
| FAM102A | 0.86 | 0.85 |
| SLC25A23 | 0.86 | 0.89 |
| ANKRD43 | 0.85 | 0.85 |
| SAPS1 | 0.84 | 0.88 |
| AC105206.1 | 0.84 | 0.86 |
| STIM1 | 0.84 | 0.83 |
| RP5-1187M17.1 | 0.83 | 0.87 |
| INF2 | 0.83 | 0.81 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RBMX2 | -0.51 | -0.57 |
| DYNLT1 | -0.49 | -0.60 |
| C9orf46 | -0.49 | -0.56 |
| TUBB2B | -0.48 | -0.50 |
| EXOSC8 | -0.48 | -0.49 |
| KIAA1949 | -0.48 | -0.39 |
| YBX1 | -0.47 | -0.40 |
| IDH1 | -0.47 | -0.39 |
| RPS8 | -0.47 | -0.52 |
| HEBP2 | -0.46 | -0.61 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006986 | response to unfolded protein | TAS | 9931472 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | TAS | 9931472 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
| ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
| GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| DOANE RESPONSE TO ANDROGEN UP | 184 | 125 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
| GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE UP | 136 | 80 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS 8HR UP | 164 | 122 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS 12HR UP | 162 | 116 | All SZGR 2.0 genes in this pathway |
| ELVIDGE HYPOXIA DN | 146 | 94 | All SZGR 2.0 genes in this pathway |
| ELVIDGE HIF1A TARGETS UP | 67 | 40 | All SZGR 2.0 genes in this pathway |
| ELVIDGE HIF1A AND HIF2A TARGETS UP | 41 | 22 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| KOINUMA COLON CANCER MSI DN | 8 | 5 | All SZGR 2.0 genes in this pathway |
| CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA FOREVER DN | 31 | 23 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
| HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
| PEREZ TP63 TARGETS | 355 | 243 | All SZGR 2.0 genes in this pathway |
| YORDY RECIPROCAL REGULATION BY ETS1 AND SP100 DN | 87 | 48 | All SZGR 2.0 genes in this pathway |
| CEBALLOS TARGETS OF TP53 AND MYC UP | 21 | 16 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
| CAFFAREL RESPONSE TO THC DN | 31 | 23 | All SZGR 2.0 genes in this pathway |
| CAFFAREL RESPONSE TO THC 8HR 5 DN | 11 | 8 | All SZGR 2.0 genes in this pathway |
| AMIT EGF RESPONSE 60 HELA | 46 | 32 | All SZGR 2.0 genes in this pathway |
| MORI SMALL PRE BII LYMPHOCYTE DN | 76 | 52 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 1 DN | 169 | 102 | All SZGR 2.0 genes in this pathway |
| UEDA CENTRAL CLOCK | 88 | 62 | All SZGR 2.0 genes in this pathway |
| LAMB CCND1 TARGETS | 19 | 14 | All SZGR 2.0 genes in this pathway |
| MENSSEN MYC TARGETS | 53 | 35 | All SZGR 2.0 genes in this pathway |
| UEDA PERIFERAL CLOCK | 169 | 111 | All SZGR 2.0 genes in this pathway |
| LEE LIVER CANCER MYC DN | 63 | 40 | All SZGR 2.0 genes in this pathway |
| BROWN MYELOID CELL DEVELOPMENT DN | 129 | 86 | All SZGR 2.0 genes in this pathway |
| GERY CEBP TARGETS | 126 | 90 | All SZGR 2.0 genes in this pathway |
| ZAMORA NOS2 TARGETS UP | 69 | 41 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS 2 | 72 | 52 | All SZGR 2.0 genes in this pathway |
| SESTO RESPONSE TO UV C0 | 107 | 72 | All SZGR 2.0 genes in this pathway |
| JACKSON DNMT1 TARGETS UP | 77 | 57 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE INCIPIENT DN | 165 | 106 | All SZGR 2.0 genes in this pathway |
| WENG POR TARGETS GLOBAL DN | 23 | 14 | All SZGR 2.0 genes in this pathway |
| XU GH1 AUTOCRINE TARGETS DN | 142 | 94 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS PEAK AT 8HR | 39 | 31 | All SZGR 2.0 genes in this pathway |
| LEE CALORIE RESTRICTION MUSCLE DN | 51 | 28 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RESPONSE TO TRABECTEDIN DN | 271 | 175 | All SZGR 2.0 genes in this pathway |
| WENG POR TARGETS LIVER DN | 20 | 11 | All SZGR 2.0 genes in this pathway |
| BILD SRC ONCOGENIC SIGNATURE | 62 | 38 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| HELLER SILENCED BY METHYLATION DN | 105 | 67 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS DN | 292 | 189 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS SILENCED BY METHYLATION DN | 281 | 179 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
| RAY TUMORIGENESIS BY ERBB2 CDC25A DN | 159 | 105 | All SZGR 2.0 genes in this pathway |
| WINTER HYPOXIA METAGENE | 242 | 168 | All SZGR 2.0 genes in this pathway |
| MUELLER PLURINET | 299 | 189 | All SZGR 2.0 genes in this pathway |
| WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS UP | 491 | 316 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 8 | 49 | 36 | All SZGR 2.0 genes in this pathway |
| KARLSSON TGFB1 TARGETS UP | 127 | 78 | All SZGR 2.0 genes in this pathway |
| WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN | 374 | 217 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP C | 92 | 60 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| GUO TARGETS OF IRS1 AND IRS2 | 98 | 67 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-320 | 654 | 660 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
| miR-369-3p | 120 | 127 | 1A,m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.