SZGR2

Summary ?

GeneID	10915
Symbol	TCERG1
Synonyms	CA150\|TAF2S\|Urn1
Description	transcription elongation regulator 1
Reference	MIM:605409\|HGNC:HGNC:15630\|Ensembl:ENSG00000113649\|HPRD:10393\|Vega:OTTHUMG00000129683
Gene type	protein-coding
Map location	5q31
Pascal p-value	0.599
Sherlock p-value	0.376
DEG p-value	DEG:Zhao_2015:p=6.61e-04:q=0.0955
Fetal beta	1.105

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DEG:Zhao_2015	RNA Sequencing analysis	Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder.
GSMA_I	Genome scan meta-analysis	Psr: 0.0032
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.01718
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00459

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CKAP5	0.96	0.97
RBM16	0.96	0.97
SMEK1	0.95	0.96
KIAA0947	0.95	0.96
NFX1	0.95	0.96
NUP153	0.94	0.96
HP1BP3	0.94	0.96
FBXO11	0.94	0.96
RNASEN	0.94	0.95
TTC3	0.94	0.97

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.82	-0.90
MT-CO2	-0.82	-0.91
FXYD1	-0.81	-0.89
AF347015.27	-0.80	-0.87
AF347015.33	-0.80	-0.87
MT-CYB	-0.79	-0.87
AF347015.8	-0.78	-0.89
HIGD1B	-0.78	-0.89
S100B	-0.78	-0.84
IFI27	-0.78	-0.87

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003702	RNA polymerase II transcription factor activity	TAS		9315662
GO:0003713	transcription coactivator activity	TAS		9315662
GO:0005515	protein binding	IPI		15383276
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
GO:0006366	transcription from RNA polymerase II promoter	TAS		9315662
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	TAS		9315662

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BARD1	-	BRCA1 associated RING domain 1	-	HPRD	15383276
CHAF1A	CAF-1 \| CAF1 \| CAF1B \| CAF1P150 \| MGC71229 \| P150	chromatin assembly factor 1, subunit A (p150)	-	HPRD,BioGRID	15456888
CHD8	DKFZp686N17164 \| HELSNF1 \| KIAA1564	chromodomain helicase DNA binding protein 8	Affinity Capture-MS	BioGRID	15456888
DNAJB9	DKFZp564F1862 \| ERdj4 \| MDG1 \| MST049 \| MSTP049	DnaJ (Hsp40) homolog, subfamily B, member 9	-	HPRD,BioGRID	15456888
FANCA	FA \| FA-H \| FA1 \| FAA \| FACA \| FAH \| FANCH \| MGC75158	Fanconi anemia, complementation group A	Two-hybrid	BioGRID	14499622
FANCC	FA3 \| FAC \| FACC \| FLJ14675	Fanconi anemia, complementation group C	Two-hybrid	BioGRID	14499622
HNRNPH1	DKFZp686A15170 \| HNRPH \| HNRPH1 \| hnRNPH	heterogeneous nuclear ribonucleoprotein H1 (H)	-	HPRD,BioGRID	15456888
HNRNPM	DKFZp547H118 \| HNRNPM4 \| HNRPM \| HNRPM4 \| HTGR1 \| NAGR1	heterogeneous nuclear ribonucleoprotein M	-	HPRD,BioGRID	15456888
HSPA1A	FLJ54303 \| FLJ54370 \| FLJ54392 \| FLJ54408 \| FLJ75127 \| HSP70-1 \| HSP70-1A \| HSP70I \| HSP72 \| HSPA1 \| HSPA1B	heat shock 70kDa protein 1A	-	HPRD	15456888
HSPA4	APG-2 \| HS24/P52 \| MGC131852 \| RY \| hsp70 \| hsp70RY	heat shock 70kDa protein 4	Affinity Capture-MS	BioGRID	15456888
HSPA5	BIP \| FLJ26106 \| GRP78 \| MIF2	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	-	HPRD,BioGRID	15456888
HSPA8	HSC54 \| HSC70 \| HSC71 \| HSP71 \| HSP73 \| HSPA10 \| LAP1 \| MGC131511 \| MGC29929 \| NIP71	heat shock 70kDa protein 8	-	HPRD,BioGRID	15456888
HTT	HD \| IT15	huntingtin	Htt interacts with CA150.	BIND	11172033
HTT	HD \| IT15	huntingtin	-	HPRD,BioGRID	11172033
LUC7L	FLJ10231 \| LUC7-LIKE \| LUC7B1 \| SR+89	LUC7-like (S. cerevisiae)	-	HPRD	15383276
MED21	SRB7 \| SURB7	mediator complex subunit 21	Affinity Capture-Western	BioGRID	9315662
NPM1	B23 \| MGC104254 \| NPM	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	-	HPRD,BioGRID	15456888
PCBP1	HNRPE1 \| HNRPX \| hnRNP-E1 \| hnRNP-X	poly(rC) binding protein 1	-	HPRD,BioGRID	15456888
PIAS4	FLJ12419 \| MGC35296 \| PIASY \| Piasg \| ZMIZ6	protein inhibitor of activated STAT, 4	-	HPRD	15383276
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	-	HPRD,BioGRID	9315662 \|10908677
RNU1A	HU1-1 \| RNU1 \| RNU1G4 \| Rnu1a1 \| U1	RNA, U1A small nuclear	Affinity Capture-RNA	BioGRID	15456888
RNU2-1	RNU2 \| U2	RNA, U2 small nuclear 1	Affinity Capture-RNA	BioGRID	15456888
SETDB1	ESET \| KG1T \| KIAA0067 \| KMT1E	SET domain, bifurcated 1	-	HPRD	15383276
SF1	D11S636 \| ZFM1 \| ZNF162	splicing factor 1	-	HPRD,BioGRID	11604498
SF3A1	PRP21 \| PRPF21 \| SAP114 \| SF3A120	splicing factor 3a, subunit 1, 120kDa	-	HPRD,BioGRID	15456888
SF3A3	PRP9 \| PRPF9 \| SAP61 \| SF3a60	splicing factor 3a, subunit 3, 60kDa	-	HPRD,BioGRID	15456888
SF3B1	PRP10 \| PRPF10 \| SAP155 \| SF3b155	splicing factor 3b, subunit 1, 155kDa	-	HPRD,BioGRID	15456888
SF3B2	SAP145 \| SF3B145 \| SF3b1 \| SF3b150	splicing factor 3b, subunit 2, 145kDa	-	HPRD,BioGRID	15456888
SF3B4	MGC10828 \| SAP49 \| SF3b49	splicing factor 3b, subunit 4, 49kDa	-	HPRD,BioGRID	15456888
SFRS1	ASF \| MGC5228 \| SF2 \| SF2p33 \| SRp30a	splicing factor, arginine/serine-rich 1	-	HPRD,BioGRID	15456888
TPM4	-	tropomyosin 4	-	HPRD,BioGRID	15456888
U2AF2	U2AF65	U2 small nuclear RNA auxiliary factor 2	-	HPRD,BioGRID	15456888

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG SPLICEOSOME	128	72	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN	205	127	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN	770	415	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP	536	340	All SZGR 2.0 genes in this pathway
SEIDEN ONCOGENESIS BY MET	88	53	All SZGR 2.0 genes in this pathway
SCHLOSSER MYC TARGETS REPRESSED BY SERUM	159	93	All SZGR 2.0 genes in this pathway
PUJANA XPRSS INT NETWORK	168	103	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
PUJANA BRCA CENTERED NETWORK	117	72	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
MANTOVANI VIRAL GPCR SIGNALING DN	49	37	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 DN	163	115	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS DN	371	218	All SZGR 2.0 genes in this pathway
YAMAZAKI TCEB3 TARGETS UP	175	116	All SZGR 2.0 genes in this pathway
MARTINEZ RESPONSE TO TRABECTEDIN DN	271	175	All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED	728	415	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
SHAFFER IRF4 TARGETS IN ACTIVATED DENDRITIC CELL	65	49	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER WITH BRCA1 MUTATED UP	56	27	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14	143	86	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE M G1	148	95	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN	336	211	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-141/200a	300	307	1A,m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	300	307	1A,m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-181	773	779	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
				hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-223	187	193	1A	hsa-miR-223	UGUCAGUUUGUCAAAUACCCC
miR-224	276	282	m8	hsa-miR-224	CAAGUCACUAGUGGUUCCGUUUA
miR-24	45	51	1A	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-299-5p	846	852	1A	hsa-miR-299-5p	UGGUUUACCGUCCCACAUACAU
miR-369-3p	475	481	1A	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-374	475	482	1A,m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-543	816	822	m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-543	816	822	m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-7	457	463	1A	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TCERG1