SZGR2

Summary ?

GeneID	11018
Symbol	TMED1
Synonyms	IL1RL1LG\|Il1rl1l\|Tp24\|p24g1
Description	transmembrane p24 trafficking protein 1
Reference	MIM:605395\|HGNC:HGNC:17291\|HPRD:05653\|
Gene type	protein-coding
Map location	19p13.2
Pascal p-value	0.032
Sherlock p-value	0.188
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs11927689	chr3	20557187	TMED1	11018		0.09		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MFHAS1	0.93	0.89
TIAM2	0.92	0.88
RP1-21O18.1	0.91	0.89
MED13L	0.91	0.89
AFF3	0.91	0.90
EML1	0.91	0.87
GRIK3	0.91	0.85
BACH2	0.90	0.84
CELSR3	0.90	0.88
SEZ6	0.90	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SERPINB6	-0.65	-0.72
HSD17B14	-0.59	-0.74
AF347015.31	-0.58	-0.79
BDH2	-0.58	-0.74
C5orf53	-0.57	-0.67
S100B	-0.57	-0.77
MGST2	-0.57	-0.70
AIFM3	-0.57	-0.69
S100A16	-0.57	-0.76
MT-CO2	-0.57	-0.79

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005102	receptor binding	TAS	Neurotransmitter (GO term level: 4)	8621446
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007267	cell-cell signaling	TAS		8621446
GO:0007165	signal transduction	TAS		8621446
GO:0006810	transport	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
LIU SOX4 TARGETS UP	137	94	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP	309	199	All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE UP	283	177	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS DN	292	189	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE UP	181	106	All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING DN	225	124	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL	162	122	All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN	157	106	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 AND SATB1 DN	180	116	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	289	295	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	288	295	1A,m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	288	295	1A,m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TMED1