SZGR2

Summary ?

GeneID	11227
Symbol	GALNT5
Synonyms	GALNAC-T5\|GALNACT5
Description	polypeptide N-acetylgalactosaminyltransferase 5
Reference	MIM:615129\|HGNC:HGNC:4127\|HPRD:09970\|
Gene type	protein-coding
Map location	2q24.1
Pascal p-value	0.62
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.02395

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg10982635	2	158161728	GALNT5	5.915E-4	-0.657	0.05	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005529	sugar binding	IEA		-
GO:0005509	calcium ion binding	IEA		-
GO:0004653	polypeptide N-acetylgalactosaminyltransferase activity	IDA		10545594
GO:0004866	endopeptidase inhibitor activity	IEA		-
GO:0016757	transferase activity, transferring glycosyl groups	IEA		-
GO:0030145	manganese ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006024	glycosaminoglycan biosynthetic process	TAS		10545594
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000139	Golgi membrane	IEA		-
GO:0005794	Golgi apparatus	IEA		-
GO:0005575	cellular_component	ND		-
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG O GLYCAN BIOSYNTHESIS	30	16	All SZGR 2.0 genes in this pathway
REACTOME O LINKED GLYCOSYLATION OF MUCINS	59	29	All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF PROTEINS	518	242	All SZGR 2.0 genes in this pathway
REACTOME POST TRANSLATIONAL PROTEIN MODIFICATION	188	116	All SZGR 2.0 genes in this pathway
NEWMAN ERCC6 TARGETS DN	39	24	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
ROVERSI GLIOMA COPY NUMBER UP	100	75	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3	720	440	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K9ME3 UP	141	75	All SZGR 2.0 genes in this pathway
WAGNER APO2 SENSITIVITY	25	14	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN	229	135	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-27	39	46	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	39	46	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GALNT5