Gene Page: GALNT5
Summary ?
GeneID | 11227 |
Symbol | GALNT5 |
Synonyms | GALNAC-T5|GALNACT5 |
Description | polypeptide N-acetylgalactosaminyltransferase 5 |
Reference | MIM:615129|HGNC:HGNC:4127|HPRD:09970| |
Gene type | protein-coding |
Map location | 2q24.1 |
Pascal p-value | 0.62 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg10982635 | 2 | 158161728 | GALNT5 | 5.915E-4 | -0.657 | 0.05 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005529 | sugar binding | IEA | - | |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0004653 | polypeptide N-acetylgalactosaminyltransferase activity | IDA | 10545594 | |
GO:0004866 | endopeptidase inhibitor activity | IEA | - | |
GO:0016757 | transferase activity, transferring glycosyl groups | IEA | - | |
GO:0030145 | manganese ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006024 | glycosaminoglycan biosynthetic process | TAS | 10545594 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000139 | Golgi membrane | IEA | - | |
GO:0005794 | Golgi apparatus | IEA | - | |
GO:0005575 | cellular_component | ND | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG O GLYCAN BIOSYNTHESIS | 30 | 16 | All SZGR 2.0 genes in this pathway |
REACTOME O LINKED GLYCOSYLATION OF MUCINS | 59 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF PROTEINS | 518 | 242 | All SZGR 2.0 genes in this pathway |
REACTOME POST TRANSLATIONAL PROTEIN MODIFICATION | 188 | 116 | All SZGR 2.0 genes in this pathway |
NEWMAN ERCC6 TARGETS DN | 39 | 24 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
ROVERSI GLIOMA COPY NUMBER UP | 100 | 75 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER WITH H3K9ME3 UP | 141 | 75 | All SZGR 2.0 genes in this pathway |
WAGNER APO2 SENSITIVITY | 25 | 14 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-27 | 39 | 46 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.