Gene Page: CHN2
Summary ?
| GeneID | 1124 |
| Symbol | CHN2 |
| Synonyms | ARHGAP3|BCH|CHN2-3|RHOGAP3 |
| Description | chimerin 2 |
| Reference | MIM:602857|HGNC:HGNC:1944|Ensembl:ENSG00000106069|HPRD:04173|Vega:OTTHUMG00000023063 |
| Gene type | protein-coding |
| Map location | 7p15.3 |
| Pascal p-value | 0.33 |
| Sherlock p-value | 0.282 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
| Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0205 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg17315135 | 7 | 29234965 | CHN2 | 1.876E-4 | -0.182 | 0.034 | DMG:Wockner_2014 |
| cg21900928 | 7 | 29294897 | CHN2 | 4.453E-4 | -0.503 | 0.045 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| snp_a-4290143 | 0 | CHN2 | 1124 | 0.04 | trans | |||
| rs16829545 | chr2 | 151977407 | CHN2 | 1124 | 1.44E-5 | trans | ||
| rs7584986 | chr2 | 184111432 | CHN2 | 1124 | 0.01 | trans | ||
| rs17745470 | chr4 | 57080197 | CHN2 | 1124 | 0.06 | trans | ||
| rs2183142 | chr4 | 159232695 | CHN2 | 1124 | 0.02 | trans | ||
| rs10035168 | chr5 | 5974295 | CHN2 | 1124 | 0.04 | trans | ||
| snp_a-4218600 | 0 | CHN2 | 1124 | 0.03 | trans | |||
| rs1380396 | chr5 | 100737044 | CHN2 | 1124 | 0.07 | trans | ||
| rs2225105 | chr9 | 25480908 | CHN2 | 1124 | 0.01 | trans | ||
| rs16955618 | chr15 | 29937543 | CHN2 | 1124 | 5.955E-6 | trans | ||
| rs1041786 | chr21 | 22617710 | CHN2 | 1124 | 0.01 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| DRD1 | 0.89 | 0.80 |
| SLC32A1 | 0.88 | 0.88 |
| HTR6 | 0.87 | 0.87 |
| DRD2 | 0.81 | 0.69 |
| GPR149 | 0.81 | 0.69 |
| GPR6 | 0.80 | 0.80 |
| FAM40B | 0.80 | 0.74 |
| TTC22 | 0.78 | 0.75 |
| C10orf41 | 0.78 | 0.60 |
| SIX3 | 0.78 | 0.13 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| HEBP2 | -0.34 | -0.56 |
| CCDC90A | -0.33 | -0.30 |
| METRNL | -0.32 | -0.45 |
| CBS | -0.31 | -0.27 |
| SNX7 | -0.31 | -0.18 |
| NEUROD6 | -0.30 | -0.07 |
| RNF182 | -0.29 | -0.28 |
| SLA | -0.29 | 0.00 |
| CSRP2 | -0.29 | -0.41 |
| KLHL1 | -0.29 | 0.01 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005096 | GTPase activator activity | TAS | 7614486 | |
| GO:0005070 | SH3/SH2 adaptor activity | TAS | 8175705 | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0019992 | diacylglycerol binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007242 | intracellular signaling cascade | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PID ERBB1 DOWNSTREAM PATHWAY | 105 | 78 | All SZGR 2.0 genes in this pathway |
| PID RAC1 REG PATHWAY | 38 | 25 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY RHO GTPASES | 113 | 81 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA MYELOID DN | 38 | 25 | All SZGR 2.0 genes in this pathway |
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS BASAL UP | 380 | 215 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
| HORIUCHI WTAP TARGETS UP | 306 | 188 | All SZGR 2.0 genes in this pathway |
| JAEGER METASTASIS DN | 258 | 141 | All SZGR 2.0 genes in this pathway |
| LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER APOCRINE VS LUMINAL | 326 | 213 | All SZGR 2.0 genes in this pathway |
| GROSS HYPOXIA VIA ELK3 UP | 209 | 139 | All SZGR 2.0 genes in this pathway |
| GROSS HYPOXIA VIA HIF1A UP | 77 | 49 | All SZGR 2.0 genes in this pathway |
| GROSS HYPOXIA VIA ELK3 AND HIF1A DN | 103 | 71 | All SZGR 2.0 genes in this pathway |
| WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| ROSS AML WITH PML RARA FUSION | 77 | 62 | All SZGR 2.0 genes in this pathway |
| ZHANG TARGETS OF EWSR1 FLI1 FUSION | 88 | 68 | All SZGR 2.0 genes in this pathway |
| HADDAD T LYMPHOCYTE AND NK PROGENITOR UP | 78 | 56 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
| KAAB HEART ATRIUM VS VENTRICLE DN | 261 | 183 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER LUMINAL B UP | 172 | 109 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
| RAY TUMORIGENESIS BY ERBB2 CDC25A DN | 159 | 105 | All SZGR 2.0 genes in this pathway |
| CHIANG LIVER CANCER SUBCLASS POLYSOMY7 UP | 79 | 50 | All SZGR 2.0 genes in this pathway |
| NIELSEN GIST | 98 | 66 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 NOT SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
| DURAND STROMA NS UP | 162 | 103 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-144 | 1475 | 1481 | m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
| miR-204/211 | 325 | 332 | 1A,m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
| hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
| miR-217 | 549 | 556 | 1A,m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
| hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU | ||||
| miR-33 | 472 | 478 | m8 | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
| hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
| miR-410 | 1128 | 1134 | m8 | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
| miR-495 | 1449 | 1455 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
| miR-543 | 443 | 449 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.