Gene Page: ADRA1B
Summary ?
GeneID | 147 |
Symbol | ADRA1B |
Synonyms | ADRA1|ALPHA1BAR |
Description | adrenoceptor alpha 1B |
Reference | MIM:104220|HGNC:HGNC:278|HPRD:00080| |
Gene type | protein-coding |
Map location | 5q33.3 |
Pascal p-value | 0.507 |
Fetal beta | -0.89 |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
ADT:Sun_2012 | Systematic Investigation of Antipsychotic Drugs and Their Targets | A total of 382 drug-target associations involving 43 antipsychotic drugs and 49 target genes. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01718 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00459 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0483 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MN1 | 0.91 | 0.89 |
SOBP | 0.90 | 0.94 |
MPPED1 | 0.89 | 0.92 |
SCUBE1 | 0.88 | 0.81 |
SLA | 0.88 | 0.88 |
TTC28 | 0.88 | 0.87 |
SATB2 | 0.88 | 0.90 |
NHSL1 | 0.87 | 0.70 |
SLC22A23 | 0.87 | 0.87 |
MYCN | 0.87 | 0.89 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SERPINB6 | -0.60 | -0.76 |
ACOT13 | -0.57 | -0.67 |
HEPN1 | -0.57 | -0.74 |
AIFM3 | -0.57 | -0.74 |
HSD17B14 | -0.57 | -0.77 |
C5orf53 | -0.57 | -0.72 |
HLA-F | -0.56 | -0.73 |
ALDOC | -0.56 | -0.67 |
CLU | -0.56 | -0.68 |
TSC22D4 | -0.56 | -0.76 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004872 | receptor activity | IEA | - | |
GO:0004937 | alpha1-adrenergic receptor activity | TAS | 1328250 | |
GO:0004935 | adrenoceptor activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001987 | vasoconstriction of artery involved in baroreceptor response to lowering of systemic arterial blood pressure | IEA | - | |
GO:0001996 | positive regulation of heart rate by epinephrine-norepinephrine | IEA | - | |
GO:0001997 | positive regulation of the force of heart contraction by epinephrine-norepinephrine | IEA | - | |
GO:0001975 | response to amphetamine | IEA | - | |
GO:0001974 | blood vessel remodeling | IEA | - | |
GO:0007188 | G-protein signaling, coupled to cAMP nucleotide second messenger | TAS | 10820200 | |
GO:0007186 | G-protein coupled receptor protein signaling pathway | TAS | 2154750 | |
GO:0016049 | cell growth | IEA | - | |
GO:0007267 | cell-cell signaling | TAS | 1328250 | |
GO:0007243 | protein kinase cascade | TAS | 10820200 | |
GO:0007165 | signal transduction | IEA | - | |
GO:0008283 | cell proliferation | TAS | 10820200 | |
GO:0008542 | visual learning | IEA | - | |
GO:0007512 | adult heart development | IEA | - | |
GO:0007626 | locomotory behavior | IEA | - | |
GO:0007275 | multicellular organismal development | TAS | 10820200 | |
GO:0042593 | glucose homeostasis | IEA | - | |
GO:0035265 | organ growth | IEA | - | |
GO:0043278 | response to morphine | IEA | - | |
GO:0048148 | behavioral response to cocaine | IEA | - | |
GO:0045819 | positive regulation of glycogen catabolic process | IEA | - | |
GO:0045818 | negative regulation of glycogen catabolic process | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000299 | integral to membrane of membrane fraction | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 1328250 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
KEGG VASCULAR SMOOTH MUSCLE CONTRACTION | 115 | 81 | All SZGR 2.0 genes in this pathway |
PID LYSOPHOSPHOLIPID PATHWAY | 66 | 53 | All SZGR 2.0 genes in this pathway |
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK | 205 | 136 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS | 305 | 177 | All SZGR 2.0 genes in this pathway |
REACTOME AMINE LIGAND BINDING RECEPTORS | 38 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA Q SIGNALLING EVENTS | 184 | 116 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA1213 SIGNALLING EVENTS | 74 | 56 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
PETRETTO HEART MASS QTL CIS UP | 28 | 15 | All SZGR 2.0 genes in this pathway |
BANDRES RESPONSE TO CARMUSTIN MGMT 24HR DN | 33 | 21 | All SZGR 2.0 genes in this pathway |
BANDRES RESPONSE TO CARMUSTIN WITHOUT MGMT 48HR DN | 32 | 25 | All SZGR 2.0 genes in this pathway |
SEMENZA HIF1 TARGETS | 36 | 32 | All SZGR 2.0 genes in this pathway |
BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN | 161 | 105 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN | 274 | 165 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
DANG MYC TARGETS UP | 143 | 100 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
OHGUCHI LIVER HNF4A TARGETS DN | 149 | 85 | All SZGR 2.0 genes in this pathway |
SERVITJA LIVER HNF1A TARGETS DN | 157 | 105 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS UP | 221 | 120 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-22 | 141 | 147 | m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.