Gene Page: DLX2

Summary ?
GeneID1746
SymbolDLX2
SynonymsTES-1|TES1
Descriptiondistal-less homeobox 2
ReferenceMIM:126255|HGNC:HGNC:2915|Ensembl:ENSG00000115844|HPRD:00527|Vega:OTTHUMG00000132276
Gene typeprotein-coding
Map location2q32
Pascal p-value0.002
Fetal beta2.219

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003682chromatin bindingIEA-
GO:0003700transcription factor activityIEA-
GO:0003700transcription factor activityTAS1354641 
GO:0003727single-stranded RNA bindingIEA-
GO:0005515protein bindingIEA-
GO:0043565sequence-specific DNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007420brain developmentTASBrain (GO term level: 7)7590232 
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
GO:0045944positive regulation of transcription from RNA polymerase II promoterIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP 8554All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS UP 456228All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN 329219All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING UP 176123All SZGR 2.0 genes in this pathway
NAGASHIMA EGF SIGNALING UP 5840All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR UP 164122All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS 355243All SZGR 2.0 genes in this pathway
TSAI RESPONSE TO IONIZING RADIATION 149101All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP 1037673All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER A 10063All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652441All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 120 MCF10A 6544All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO DN 200112All SZGR 2.0 genes in this pathway
RORIE TARGETS OF EWSR1 FLI1 FUSION UP 3022All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP 240152All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D5 3926All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR UP 156101All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK UP 244151All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN 312203All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 1 3324All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS 245148All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS UP 317208All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP 461298All SZGR 2.0 genes in this pathway
ENGELMANN CANCER PROGENITORS UP 4831All SZGR 2.0 genes in this pathway
CHEN HOXA5 TARGETS 9HR UP 223132All SZGR 2.0 genes in this pathway
FRASOR RESPONSE TO SERM OR FULVESTRANT UP 2414All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069729All SZGR 2.0 genes in this pathway
WANG MLL TARGETS 289188All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF 516308All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/506654660m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-129-5p715721m8hsa-miR-129brainCUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5pCUUUUUGCGGUCUGGGCUUGCU
miR-219519571Ahsa-miR-21brainUAGCUUAUCAGACUGAUGUUGA
hsa-miR-590GAGCUUAUUCAUAAAAGUGCAG
miR-216107210781Ahsa-miR-216UAAUCUCAGCUGGCAACUGUG
miR-299-5p861867m8hsa-miR-299-5pUGGUUUACCGUCCCACAUACAU
miR-3818278331Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-4507157211Ahsa-miR-450UUUUUGCGAUGUGUUCCUAAUA