SZGR2

Summary ?

GeneID	1826
Symbol	DSCAM
Synonyms	CHD2\|CHD2-42\|CHD2-52
Description	Down syndrome cell adhesion molecule
Reference	MIM:602523\|HGNC:HGNC:3039\|Ensembl:ENSG00000171587\|HPRD:03953\|Vega:OTTHUMG00000086732
Gene type	protein-coding
Map location	21q22.2
Pascal p-value	0.267
Sherlock p-value	0.482
Fetal beta	0.372
eGene	Myers' cis & trans Meta
Support	CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
DNM:Xu_2012	Whole Exome Sequencing analysis	De novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
DSCAM	chr21	41450663	C	T	NM_001271534 NM_001389 NR_073202	. . .	silent silent npcRNA			Schizophrenia	DNM:Fromer_2014
DSCAM	chr21	41710090	G	T	NM_001271534 NM_001389 NR_073202	p.574T>K p.574T>K .	missense missense npcRNA			Schizophrenia	DNM:Xu_2012

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs2019147	chr21	42422183	DSCAM	1826		0.02		cis
rs7530588	chr1	98913842	DSCAM	1826		0.07		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
COG1	0.86	0.80
MAPRE3	0.84	0.78
WIPI2	0.83	0.75
RANGAP1	0.83	0.79
BAP1	0.82	0.79
ZER1	0.81	0.77
GPI	0.81	0.78
PGBD5	0.81	0.79
ENTPD6	0.81	0.81
CACNB1	0.80	0.77

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.59	-0.34
AF347015.18	-0.56	-0.34
IL32	-0.53	-0.41
GNG11	-0.51	-0.40
NOSTRIN	-0.49	-0.30
AF347015.8	-0.49	-0.27
MT-CO2	-0.48	-0.27
MT-ATP8	-0.48	-0.29
AP002478.3	-0.47	-0.35
AF347015.2	-0.47	-0.22

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007399	nervous system development	TAS	neurite (GO term level: 5)	9426258
GO:0007155	cell adhesion	TAS		9426258
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0005624	membrane fraction	TAS		9426258
GO:0005886	plasma membrane	TAS		9426258
GO:0005887	integral to plasma membrane	TAS		9426258

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID ERA GENOMIC PATHWAY	65	37	All SZGR 2.0 genes in this pathway
PID HNF3A PATHWAY	44	29	All SZGR 2.0 genes in this pathway
REACTOME CELL CELL COMMUNICATION	120	77	All SZGR 2.0 genes in this pathway
REACTOME DSCAM INTERACTIONS	11	10	All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS DN	139	76	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP	544	308	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN	357	212	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS DN	142	94	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4	307	185	All SZGR 2.0 genes in this pathway
JEPSEN SMRT TARGETS	33	23	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY 4NQO	38	24	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE DN	195	135	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN	258	160	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3	349	234	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3	435	318	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR UP	324	193	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7	403	240	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-140	139	146	1A,m8	hsa-miR-140^brain	AGUGGUUUUACCCUAUGGUAG
miR-182	100	107	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-30-3p	135	141	m8	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	135	141	m8	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-378*	226	232	m8	hsa-miR-422b	CUGGACUUGGAGUCAGAAGGCC
miR-378*	226	232	m8	hsa-miR-422a	CUGGACUUAGGGUCAGAAGGCC
miR-96	101	107	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DSCAM