Gene Page: DSCAM
Summary ?
GeneID | 1826 |
Symbol | DSCAM |
Synonyms | CHD2|CHD2-42|CHD2-52 |
Description | Down syndrome cell adhesion molecule |
Reference | MIM:602523|HGNC:HGNC:3039|Ensembl:ENSG00000171587|HPRD:03953|Vega:OTTHUMG00000086732 |
Gene type | protein-coding |
Map location | 21q22.2 |
Pascal p-value | 0.267 |
Sherlock p-value | 0.482 |
Fetal beta | 0.372 |
eGene | Myers' cis & trans Meta |
Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
DNM:Xu_2012 | Whole Exome Sequencing analysis | De novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
DSCAM | chr21 | 41450663 | C | T | NM_001271534 NM_001389 NR_073202 | . . . | silent silent npcRNA | Schizophrenia | DNM:Fromer_2014 | ||
DSCAM | chr21 | 41710090 | G | T | NM_001271534 NM_001389 NR_073202 | p.574T>K p.574T>K . | missense missense npcRNA | Schizophrenia | DNM:Xu_2012 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs2019147 | chr21 | 42422183 | DSCAM | 1826 | 0.02 | cis | ||
rs7530588 | chr1 | 98913842 | DSCAM | 1826 | 0.07 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
COG1 | 0.86 | 0.80 |
MAPRE3 | 0.84 | 0.78 |
WIPI2 | 0.83 | 0.75 |
RANGAP1 | 0.83 | 0.79 |
BAP1 | 0.82 | 0.79 |
ZER1 | 0.81 | 0.77 |
GPI | 0.81 | 0.78 |
PGBD5 | 0.81 | 0.79 |
ENTPD6 | 0.81 | 0.81 |
CACNB1 | 0.80 | 0.77 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.59 | -0.34 |
AF347015.18 | -0.56 | -0.34 |
IL32 | -0.53 | -0.41 |
GNG11 | -0.51 | -0.40 |
NOSTRIN | -0.49 | -0.30 |
AF347015.8 | -0.49 | -0.27 |
MT-CO2 | -0.48 | -0.27 |
MT-ATP8 | -0.48 | -0.29 |
AP002478.3 | -0.47 | -0.35 |
AF347015.2 | -0.47 | -0.22 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 9426258 |
GO:0007155 | cell adhesion | TAS | 9426258 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0005624 | membrane fraction | TAS | 9426258 | |
GO:0005886 | plasma membrane | TAS | 9426258 | |
GO:0005887 | integral to plasma membrane | TAS | 9426258 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID ERA GENOMIC PATHWAY | 65 | 37 | All SZGR 2.0 genes in this pathway |
PID HNF3A PATHWAY | 44 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CELL COMMUNICATION | 120 | 77 | All SZGR 2.0 genes in this pathway |
REACTOME DSCAM INTERACTIONS | 11 | 10 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS DN | 139 | 76 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS DN | 357 | 212 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
XU GH1 AUTOCRINE TARGETS DN | 142 | 94 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
JEPSEN SMRT TARGETS | 33 | 23 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY 4NQO | 38 | 24 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE DN | 195 | 135 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR UP | 324 | 193 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-140 | 139 | 146 | 1A,m8 | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
miR-182 | 100 | 107 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-30-3p | 135 | 141 | m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
miR-378* | 226 | 232 | m8 | hsa-miR-422b | CUGGACUUGGAGUCAGAAGGCC |
hsa-miR-422a | CUGGACUUAGGGUCAGAAGGCC | ||||
miR-96 | 101 | 107 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.