SZGR2

Summary ?

GeneID	22854
Symbol	NTNG1
Synonyms	Lmnt1
Description	netrin G1
Reference	MIM:608818\|HGNC:HGNC:23319\|Ensembl:ENSG00000162631\|HPRD:16389\|Vega:OTTHUMG00000010965
Gene type	protein-coding
Map location	1p13.3
Pascal p-value	0.154
Fetal beta	-2.486
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	2	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg20170831	1	107682818	NTNG1	1.99E-8	-0.023	6.92E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs9261489	chr6	30109481	NTNG1	22854		0.15		trans
rs9261519	chr6	30117100	NTNG1	22854		0.1		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
EXOC8	0.92	0.93
ZFYVE20	0.92	0.93
KIF1B	0.92	0.94
GRLF1	0.91	0.92
PCNX	0.91	0.94
THUMPD1	0.91	0.93
SMURF1	0.91	0.92
ERCC6	0.91	0.93
OSBP	0.91	0.92
HERC1	0.91	0.92

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.72	-0.76
AF347015.21	-0.71	-0.80
FXYD1	-0.71	-0.74
MT-CO2	-0.71	-0.76
IFI27	-0.70	-0.74
HIGD1B	-0.70	-0.76
C1orf54	-0.69	-0.81
ENHO	-0.68	-0.74
METRN	-0.67	-0.74
VAMP5	-0.67	-0.72

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		14595443
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007409	axonogenesis	ISS	neuron, axon, neurite (GO term level: 12)	-
GO:0007399	nervous system development	IEA	neurite (GO term level: 5)	-
GO:0007275	multicellular organismal development	IEA		-
GO:0030154	cell differentiation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005578	proteinaceous extracellular matrix	IEA		-
GO:0005886	plasma membrane	IEA		-
GO:0046658	anchored to plasma membrane	ISS		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE DN	384	220	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
ULE SPLICING VIA NOVA2	43	38	All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED	728	415	All SZGR 2.0 genes in this pathway
JEPSEN SMRT TARGETS	33	23	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING	246	152	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3	142	103	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3	210	148	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP	259	159	All SZGR 2.0 genes in this pathway
NABA ECM GLYCOPROTEINS	196	99	All SZGR 2.0 genes in this pathway
NABA CORE MATRISOME	275	148	All SZGR 2.0 genes in this pathway
NABA BASEMENT MEMBRANES	40	22	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-145	977	983	1A	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-182	754	760	m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-199	975	982	1A,m8	hsa-miR-199a	CCCAGUGUUCAGACUACCUGUUC
miR-199	975	982	1A,m8	hsa-miR-199b	CCCAGUGUUUAGACUAUCUGUUC
miR-219	773	779	m8	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-30-5p	907	913	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-539	862	868	m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU
miR-9	939	945	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NTNG1