Gene Page: CEP164
Summary ?
GeneID | 22897 |
Symbol | CEP164 |
Synonyms | NPHP15 |
Description | centrosomal protein 164kDa |
Reference | MIM:614848|HGNC:HGNC:29182|Ensembl:ENSG00000110274|HPRD:10854|Vega:OTTHUMG00000167070 |
Gene type | protein-coding |
Map location | 11q23.3 |
Pascal p-value | 0.838 |
Sherlock p-value | 0.449 |
Fetal beta | -0.262 |
eGene | Cerebellar Hemisphere Cerebellum Myers' cis & trans |
Support | CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
CEP164 | chr11 | 117209324 | A | G | NM_001271933 NM_014956 | p.8I>V p.8I>V | missense missense | Schizophrenia | DNM:Fromer_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs16955618 | chr15 | 29937543 | CEP164 | 22897 | 2.441E-4 | trans | ||
rs7171526 | chr15 | 62709923 | CEP164 | 22897 | 0.14 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](/SZGR/GeneImg/CEP164_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
KIAA1715 | 0.89 | 0.90 |
OPA1 | 0.88 | 0.91 |
RAB6A | 0.88 | 0.86 |
C5orf22 | 0.88 | 0.88 |
RPRD1A | 0.88 | 0.90 |
ZDHHC17 | 0.88 | 0.90 |
CAB39 | 0.88 | 0.88 |
GDAP1 | 0.88 | 0.89 |
USP14 | 0.88 | 0.87 |
ARMCX3 | 0.88 | 0.88 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
HIGD1B | -0.61 | -0.62 |
FXYD1 | -0.60 | -0.60 |
CSAG1 | -0.58 | -0.58 |
MT-CO2 | -0.58 | -0.56 |
AF347015.21 | -0.58 | -0.53 |
AF347015.31 | -0.57 | -0.57 |
GSDMD | -0.57 | -0.60 |
METRN | -0.57 | -0.60 |
IFI27 | -0.57 | -0.59 |
AF347015.2 | -0.57 | -0.52 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID ATR PATHWAY | 39 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CYCLE | 421 | 253 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CYCLE MITOTIC | 325 | 185 | All SZGR 2.0 genes in this pathway |
REACTOME RECRUITMENT OF MITOTIC CENTROSOME PROTEINS AND COMPLEXES | 66 | 43 | All SZGR 2.0 genes in this pathway |
REACTOME LOSS OF NLP FROM MITOTIC CENTROSOMES | 59 | 38 | All SZGR 2.0 genes in this pathway |
REACTOME MITOTIC G2 G2 M PHASES | 81 | 50 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
ODONNELL METASTASIS UP | 82 | 58 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
SASAKI ADULT T CELL LEUKEMIA | 176 | 122 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
KYNG WERNER SYNDROM AND NORMAL AGING UP | 93 | 62 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS DN | 242 | 146 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 483 | 489 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.