Gene Page: RPIA
Summary ?
GeneID | 22934 |
Symbol | RPIA |
Synonyms | RPI|RPIAD |
Description | ribose 5-phosphate isomerase A |
Reference | MIM:180430|HGNC:HGNC:10297|Ensembl:ENSG00000153574|HPRD:01589|Vega:OTTHUMG00000130333 |
Gene type | protein-coding |
Map location | 2p11.2 |
Pascal p-value | 0.132 |
Sherlock p-value | 8.849E-6 |
Fetal beta | 0.103 |
DMG | 1 (# studies) |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.0004 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg13293721 | 2 | 88990738 | RPIA | 1.19E-9 | -0.014 | 1.28E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MTMR12 | 0.90 | 0.91 |
RAPGEF2 | 0.89 | 0.89 |
BTBD9 | 0.87 | 0.87 |
TRAPPC10 | 0.87 | 0.86 |
MAGI2 | 0.87 | 0.88 |
USP46 | 0.86 | 0.87 |
DOCK3 | 0.86 | 0.86 |
ARNT2 | 0.86 | 0.86 |
HTT | 0.86 | 0.86 |
PHLPP2 | 0.86 | 0.86 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.57 | -0.50 |
DBI | -0.57 | -0.61 |
C1orf54 | -0.56 | -0.58 |
GNG11 | -0.55 | -0.54 |
C1orf61 | -0.54 | -0.59 |
IL32 | -0.53 | -0.49 |
RHOC | -0.53 | -0.55 |
AC098691.2 | -0.52 | -0.52 |
RAB34 | -0.52 | -0.54 |
SYCP3 | -0.52 | -0.53 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004751 | ribose-5-phosphate isomerase activity | EXP | 14988808 | |
GO:0004751 | ribose-5-phosphate isomerase activity | IEA | - | |
GO:0004751 | ribose-5-phosphate isomerase activity | NAS | 7758956 | |
GO:0016853 | isomerase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0009052 | pentose-phosphate shunt, non-oxidative branch | IEA | - | |
GO:0009052 | pentose-phosphate shunt, non-oxidative branch | NAS | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005829 | cytosol | EXP | 14988808 | |
GO:0005622 | intracellular | NAS | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PENTOSE PHOSPHATE PATHWAY | 27 | 14 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF CARBOHYDRATES | 247 | 154 | All SZGR 2.0 genes in this pathway |
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 UP | 146 | 86 | All SZGR 2.0 genes in this pathway |
AKL HTLV1 INFECTION DN | 68 | 41 | All SZGR 2.0 genes in this pathway |
SCHLOSSER MYC TARGETS AND SERUM RESPONSE DN | 47 | 34 | All SZGR 2.0 genes in this pathway |
KIM MYCN AMPLIFICATION TARGETS UP | 92 | 64 | All SZGR 2.0 genes in this pathway |
PUJANA XPRSS INT NETWORK | 168 | 103 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA CENTERED NETWORK | 117 | 72 | All SZGR 2.0 genes in this pathway |
BERTUCCI INVASIVE CARCINOMA DUCTAL VS LOBULAR UP | 25 | 17 | All SZGR 2.0 genes in this pathway |
GARCIA TARGETS OF FLI1 AND DAX1 DN | 176 | 104 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP | 236 | 139 | All SZGR 2.0 genes in this pathway |
GOLDRATH HOMEOSTATIC PROLIFERATION | 171 | 102 | All SZGR 2.0 genes in this pathway |
SCHUHMACHER MYC TARGETS UP | 80 | 57 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR UP | 156 | 101 | All SZGR 2.0 genes in this pathway |
WELCSH BRCA1 TARGETS DN | 141 | 92 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS DN | 314 | 188 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G | 171 | 96 | All SZGR 2.0 genes in this pathway |
TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
PUJANA BREAST CANCER WITH BRCA1 MUTATED UP | 56 | 27 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 426 | 432 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA | ||||
miR-124/506 | 77 | 83 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA | ||||
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-129-5p | 279 | 285 | 1A | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.