Gene Page: PDZRN3
Summary ?
| GeneID | 23024 |
| Symbol | PDZRN3 |
| Synonyms | LNX3|SEMACAP3|SEMCAP3 |
| Description | PDZ domain containing ring finger 3 |
| Reference | MIM:609729|HGNC:HGNC:17704|Ensembl:ENSG00000121440|HPRD:15115|Vega:OTTHUMG00000158865 |
| Gene type | protein-coding |
| Map location | 3p13 |
| Pascal p-value | 0.308 |
| Fetal beta | -0.439 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Ambalavanan_2016 | Whole Exome Sequencing | This dataset includes 20 de novo mutations detected in 17 COS probands. | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.04047 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04359 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| PDZRN3 | chr3 | 73651603 | C | T | NM_015009 | p.(Asp274Asn) | nonsynonymous SNV | 0.986 | Childhood-onset schizophrenia | DNM:Ambalavanan_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| USP24 | 0.97 | 0.97 |
| NSD1 | 0.97 | 0.97 |
| SMG1 | 0.96 | 0.98 |
| BIRC6 | 0.96 | 0.98 |
| MED1 | 0.96 | 0.97 |
| C10orf18 | 0.96 | 0.97 |
| CHD9 | 0.96 | 0.98 |
| AFF4 | 0.95 | 0.95 |
| NCOA3 | 0.95 | 0.96 |
| LRP6 | 0.95 | 0.96 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.69 | -0.84 |
| FXYD1 | -0.67 | -0.83 |
| MT-CO2 | -0.67 | -0.84 |
| IFI27 | -0.67 | -0.83 |
| HIGD1B | -0.66 | -0.84 |
| AIFM3 | -0.66 | -0.71 |
| AF347015.27 | -0.66 | -0.79 |
| HSD17B14 | -0.66 | -0.75 |
| RAMP1 | -0.65 | -0.76 |
| TSC22D4 | -0.65 | -0.73 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
| DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
| EBAUER TARGETS OF PAX3 FOXO1 FUSION DN | 48 | 31 | All SZGR 2.0 genes in this pathway |
| DAIRKEE TERT TARGETS DN | 124 | 79 | All SZGR 2.0 genes in this pathway |
| KIM MYCN AMPLIFICATION TARGETS UP | 92 | 64 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
| KAAB HEART ATRIUM VS VENTRICLE DN | 261 | 183 | All SZGR 2.0 genes in this pathway |
| MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
| RIGGI EWING SARCOMA PROGENITOR DN | 191 | 123 | All SZGR 2.0 genes in this pathway |
| ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
| GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
| CHANG CORE SERUM RESPONSE DN | 209 | 137 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 60HR DN | 277 | 166 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| CAIRO LIVER DEVELOPMENT UP | 166 | 105 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
| MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION UP | 570 | 339 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY LUMINAL MATURE DN | 99 | 74 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-330 | 765 | 771 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
| miR-34/449 | 389 | 395 | 1A | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
| miR-381 | 82 | 88 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| miR-433-3p | 812 | 818 | m8 | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
| miR-486 | 702 | 709 | 1A,m8 | hsa-miR-486 | UCCUGUACUGAGCUGCCCCGAG |
| miR-493-5p | 700 | 706 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-494 | 445 | 451 | 1A | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.