Gene Page: SMG1
Summary ?
| GeneID | 23049 |
| Symbol | SMG1 |
| Synonyms | 61E3.4|ATX|LIP |
| Description | SMG1 phosphatidylinositol 3-kinase-related kinase |
| Reference | MIM:607032|HGNC:HGNC:30045|Ensembl:ENSG00000157106|HPRD:06123|Vega:OTTHUMG00000166900 |
| Gene type | protein-coding |
| Map location | 16p12.3 |
| Pascal p-value | 0.166 |
| Sherlock p-value | 0.203 |
| Fetal beta | 1.941 |
| eGene | Cerebellar Hemisphere Myers' cis & trans |
| Support | CompositeSet Darnell FMRP targets Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs1548445 | chr16 | 19691582 | SMG1 | 23049 | 0.13 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ZNF629 | 0.93 | 0.93 |
| NAV1 | 0.93 | 0.95 |
| ZMIZ1 | 0.93 | 0.92 |
| SH3PXD2B | 0.93 | 0.93 |
| DLG5 | 0.92 | 0.93 |
| BAT2L | 0.92 | 0.92 |
| KIAA1549 | 0.91 | 0.92 |
| JRK | 0.91 | 0.93 |
| ARID1B | 0.91 | 0.93 |
| TBC1D16 | 0.91 | 0.90 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C5orf53 | -0.67 | -0.77 |
| AF347015.31 | -0.66 | -0.86 |
| AF347015.27 | -0.64 | -0.83 |
| MT-CO2 | -0.64 | -0.84 |
| S100B | -0.63 | -0.77 |
| FXYD1 | -0.63 | -0.79 |
| AF347015.33 | -0.62 | -0.79 |
| IFI27 | -0.62 | -0.77 |
| HIGD1B | -0.62 | -0.80 |
| MT-CYB | -0.61 | -0.80 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 11544179 | |
| GO:0004428 | inositol or phosphatidylinositol kinase activity | IDA | 11331269 | |
| GO:0004674 | protein serine/threonine kinase activity | IDA | 11544179 |15175154 | |
| GO:0004674 | protein serine/threonine kinase activity | NAS | 11331269 | |
| GO:0016740 | transferase activity | IEA | - | |
| GO:0030145 | manganese ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000184 | nuclear-transcribed mRNA catabolic process, nonsense-mediated decay | IDA | 11544179 | |
| GO:0000184 | nuclear-transcribed mRNA catabolic process, nonsense-mediated decay | NAS | 11331269 | |
| GO:0000184 | nuclear-transcribed mRNA catabolic process, nonsense-mediated decay | TAS | 16488880 | |
| GO:0006406 | mRNA export from nucleus | TAS | 16488880 | |
| GO:0006281 | DNA repair | IEA | - | |
| GO:0018105 | peptidyl-serine phosphorylation | IDA | 11544179 |15175154 | |
| GO:0018105 | peptidyl-serine phosphorylation | TAS | 14636577 | |
| GO:0046854 | phosphoinositide phosphorylation | IDA | 11331269 | |
| GO:0046777 | protein amino acid autophosphorylation | IDA | 11331269 |11544179 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IDA | 14636577 |15175154 | |
| GO:0005737 | cytoplasm | IC | 11331269 | |
| GO:0005737 | cytoplasm | IDA | 14636577 |15175154 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME METABOLISM OF MRNA | 284 | 128 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF RNA | 330 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME NONSENSE MEDIATED DECAY ENHANCED BY THE EXON JUNCTION COMPLEX | 176 | 57 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
| GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS TURQUOISE UP | 79 | 50 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
| PARK HSC VS MULTIPOTENT PROGENITORS UP | 19 | 14 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
| KANG IMMORTALIZED BY TERT DN | 102 | 67 | All SZGR 2.0 genes in this pathway |
| RADMACHER AML PROGNOSIS | 78 | 52 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
| JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
| BILD CTNNB1 ONCOGENIC SIGNATURE | 82 | 52 | All SZGR 2.0 genes in this pathway |
| DURCHDEWALD SKIN CARCINOGENESIS DN | 264 | 168 | All SZGR 2.0 genes in this pathway |
| FOSTER TOLERANT MACROPHAGE UP | 156 | 92 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 2D DN | 64 | 35 | All SZGR 2.0 genes in this pathway |
| MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
| BREDEMEYER RAG SIGNALING NOT VIA ATM UP | 62 | 29 | All SZGR 2.0 genes in this pathway |
| WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
| DING LUNG CANCER BY MUTATION RATE | 20 | 18 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
| CHANDRAN METASTASIS UP | 221 | 135 | All SZGR 2.0 genes in this pathway |
| FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
| ZWANG EGF INTERVAL UP | 105 | 46 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-1/206 | 351 | 357 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
| hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
| hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
| miR-125/351 | 175 | 182 | 1A,m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
| hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
| miR-128 | 888 | 894 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-138 | 4573 | 4579 | m8 | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
| miR-142-3p | 589 | 596 | 1A,m8 | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
| miR-216 | 3147 | 3153 | m8 | hsa-miR-216 | UAAUCUCAGCUGGCAACUGUG |
| miR-30-3p | 4583 | 4589 | 1A | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
| hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
| miR-329 | 367 | 373 | 1A | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
| miR-33 | 3432 | 3439 | 1A,m8 | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
| hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
| miR-362 | 791 | 797 | m8 | hsa-miR-362 | AAUCCUUGGAACCUAGGUGUGAGU |
| miR-377 | 3385 | 3391 | 1A | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
| miR-384 | 145 | 151 | m8 | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
| hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA | ||||
| miR-485-3p | 4662 | 4669 | 1A,m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
| miR-485-5p | 59 | 66 | 1A,m8 | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
| miR-490 | 3221 | 3227 | m8 | hsa-miR-490 | CAACCUGGAGGACUCCAUGCUG |
| miR-493-5p | 867 | 873 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU | ||||
| miR-504 | 210 | 217 | 1A,m8 | hsa-miR-504 | AGACCCUGGUCUGCACUCUAU |
| miR-7 | 3522 | 3528 | m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.