Gene Page: POGZ
Summary ?
GeneID | 23126 |
Symbol | POGZ |
Synonyms | MRD37|WHSUS|ZNF280E|ZNF635|ZNF635m |
Description | pogo transposable element with ZNF domain |
Reference | MIM:614787|HGNC:HGNC:18801|Ensembl:ENSG00000143442|HPRD:11445|Vega:OTTHUMG00000012499 |
Gene type | protein-coding |
Map location | 1q21.3 |
Sherlock p-value | 0.775 |
TADA p-value | 0.004 |
Fetal beta | 2.346 |
DMG | 1 (# studies) |
eGene | Cerebellar Hemisphere Cerebellum |
Support | CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
DNM:Gulsuner_2013 | Whole Exome Sequencing analysis | 155 DNMs identified by exome sequencing of quads or trios of schizophrenia individuals and their parents. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
POGZ | chr1 | 151377574..151377575 | CA | C | NM_001194937 NM_001194938 NM_015100 NM_145796 NM_207171 | . . . . . | frameshift frameshift frameshift frameshift frameshift | Schizophrenia | DNM:Fromer_2014 | ||
POGZ | chr1 | 151377883 | T | C | NM_001194937 NM_001194938 NM_015100 NM_145796 NM_207171 | p.1201T>A p.1148T>A p.1210T>A p.1115T>A p.1157T>A | missense missense missense missense missense | Schizophrenia | DNM:Gulsuner_2013 |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg10700717 | 1 | 151430878 | POGZ | 4.59E-8 | -0.023 | 1.25E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RAPGEF3 | 0.79 | 0.78 |
FAM38A | 0.77 | 0.75 |
MICALL2 | 0.76 | 0.77 |
SLC27A1 | 0.75 | 0.76 |
ACACB | 0.74 | 0.69 |
FBXW4 | 0.73 | 0.68 |
DNHD1 | 0.73 | 0.75 |
KIAA1755 | 0.72 | 0.66 |
TJAP1 | 0.72 | 0.74 |
PEAR1 | 0.72 | 0.68 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
PSMA6 | -0.59 | -0.68 |
SUB1 | -0.58 | -0.59 |
RWDD1 | -0.58 | -0.62 |
VPS29 | -0.57 | -0.59 |
COX16 | -0.57 | -0.64 |
MRPL1 | -0.57 | -0.61 |
NFU1 | -0.56 | -0.60 |
PSMC6 | -0.55 | -0.55 |
MRPL47 | -0.55 | -0.58 |
MRPS23 | -0.55 | -0.60 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003677 | DNA binding | IEA | - | |
GO:0005515 | protein binding | IPI | 10976766 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0045449 | regulation of transcription | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IDA | 18029348 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
CHARAFE BREAST CANCER LUMINAL VS BASAL UP | 380 | 215 | All SZGR 2.0 genes in this pathway |
WANG CLIM2 TARGETS UP | 269 | 146 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL UP | 316 | 190 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
LOCKWOOD AMPLIFIED IN LUNG CANCER | 214 | 139 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP | 236 | 139 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER MYC DN | 63 | 40 | All SZGR 2.0 genes in this pathway |
PENG GLUCOSE DEPRIVATION DN | 169 | 112 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA UP | 98 | 64 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D4 | 55 | 37 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV SCC DN | 123 | 86 | All SZGR 2.0 genes in this pathway |
GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
LIN MELANOMA COPY NUMBER UP | 73 | 53 | All SZGR 2.0 genes in this pathway |
ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G1 UP | 113 | 70 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 367 | 373 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-101 | 1275 | 1282 | 1A,m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-144 | 1276 | 1282 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-208 | 548 | 554 | 1A | hsa-miR-208 | AUAAGACGAGCAAAAAGCUUGU |
miR-221/222 | 492 | 498 | m8 | hsa-miR-221brain | AGCUACAUUGUCUGCUGGGUUUC |
hsa-miR-222brain | AGCUACAUCUGGCUACUGGGUCUC | ||||
miR-24 | 198 | 205 | 1A,m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
miR-320 | 1720 | 1726 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-34/449 | 1186 | 1193 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-410 | 560 | 566 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-499 | 548 | 554 | 1A | hsa-miR-499 | UUAAGACUUGCAGUGAUGUUUAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.